ZuoTi.Pro
Question

Which of the following is the template for transcription? The molecule that carries codons The molecule...

Which of the following is the template for transcription?

The molecule that carries codons

The molecule that carries anticodons

The molecule that carries base triplets

The molecule that carries amino acids

The molecule that carries tRNA

Cytokinesis begins with the formation of an indentation around the cell called the

asters.

centromere.

cleavage furrow.

equator.
science   Anatomy-And-Physiology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

which of the following is the template for transcription

Answer: The molecules that carries tRNA

Rational: The DNA has to changed to RNA for further growth, so that the DNA will get copied and formed as the RNA. For to achieve this process, this has to undergone some process like transcription and translation.

tRNA is otherwise called as Transfer RNA. It has the amino acid which will used in the template for transcription.

Cytokinesis begins with the formation of an indentation around the cell called the
Answer: cleavage furrow.

0 0
Add a comment
Know the answer?
Add Answer to:
Which of the following is the template for transcription? The molecule that carries codons The molecule...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • In TRANSCRIPTION, which molecule is a template and which is forming the newly constructed polymer? Here...

    In TRANSCRIPTION, which molecule is a template and which is forming the newly constructed polymer? Here are the choices: Template New polymer Neither template nor monomer Genome sequence Insert choices to each of the following: tRNA mRNA Promoter rRNA amino acid Template New polymer Neither template nor monomer Genome sequence tRNA mRNA Promoter rRNA amino acid

  • 4. Use the following terms to fill in the blanks below. cleavage furrow centromere equator mitotic...

    4. Use the following terms to fill in the blanks below. cleavage furrow centromere equator mitotic spindle cytokinesis sister chromatids c hromosomes During metaphase, chromosomes line up along the of the cell. The two are held together with a refers to the division of the cytoplasm into two daughter cells. Genetic information in cells is contained in structures called • During anaphase, part of the can be seen attached to the centromere of each sister chromatid. The constricted appearance of...

  • Question 3 (4 pts): The following table provides just enough information about a section of a...

    Question 3 (4 pts): The following table provides just enough information about a section of a particular gene to allow you to determine: (a) the sequence of the base pairs along the DNA, (b) which DNA strand serves as the template for mRNA transcription, (c) the mRNA nucleotide sequence, (d) the tRNA anticodons, and (c) the amino acid sequence of the polypeptide. Complete the table and make sure you indicate which DNA strand is the template for mRNA transcription and...

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

  • 10. With regard to transcription, the enzyme begins of a DNA transcribing RNA after it attaches...

    10. With regard to transcription, the enzyme begins of a DNA transcribing RNA after it attaches to the molecule. With regard to translation, the begins translating a polypeptide after it attaches to the __ of an mRNA molecule. Start and stop codons are involved in the process of The start codon is , while the stop codons are 11. and Does the start codon specify an amino acid? If so, which one(s)? Do the stop codons specify an amino acid?...

  • c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose...

    c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

  • The following sequence represents triplets on DNA TAC CAG ATA CAC TCC CCT GCG ACT A....

    The following sequence represents triplets on DNA TAC CAG ATA CAC TCC CCT GCG ACT A. Give the mRNA codons and tRNA anticodons that correspond with this sequence. B. Using the above piece of DNA, show a deletion, insertion, a substitution, and nonsense mutation. Which ones are frame-shift mutations? Are any of your mutations missense? Use the table of codons and amino acids in the textbook to answer this part of the question. For microbiology

  • 2. The following sequence is a wild-type gene that encodes a tRNA-his molecule that recognizes the...

    2. The following sequence is a wild-type gene that encodes a tRNA-his molecule that recognizes the codon 5- CAU-3' on all mRNAs in the bacterial cell. The sequence given is from the point where transcription starts (called "+1") to the point where transcription ends (called the "terminator"). 5'-CCCGTTGCTCAGATCTGGATATCCTTCCTGCATAGAATCGCTTGCTGAAGCTGATACGCGCAACGGT-3' 3'-GGGCAACGAGTCTAGACCTATAGGAAGGACGTATCTTAGCGAACGACTTCGACTATGCGCGTTGCCA-5' a. Which strand (the upper or the lower) is used as the template in transcription? UNDERLINE THE CORRECT CHOICE b. Write out the amino acid sequence the protein, if any, that...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT