S Review View It, lea .--. . rrnalI1No Spac Heading 1 Heading 2 Title Subtitle Subtle Ern Emphas ...
repulsion within the protein 10. Which of the following amino acids do not contain a chiral carbon? a. Proline b. Alanine c. Glycine d. Phenylalanine e. Tyrosine 11. You want to determine an amino acid sequence for a particular polypeptide. So you degrade the peptid and get the following fragments. Determine the peptide sequence. Digested with typsin: Met-Val-Ser-Thr-Lys Val-lle-Trp-Thr-Leu-Met-lle Leu-Phe-Asn-Glu-Ser-Arg Digested with chymotrypsin: Asn-Glu-Ser-Arg-Val-lle-Trp Thr-Leu-Met-lle Met-Val-Ser-Thr-Lys-Leu-Phe a. Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys b. Val-lle-Trp-Thr-Leu-Met-lle-Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg c. Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-le d. Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg-Val-le-Trp-Thr-Leu-Met-lle e. Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
Based on the chemical properties of the residues, which of the following sequences could form the following? At least one should be placed in each category. Based on the chemical properties of the residues, which of the following sequences could form the following? At least one should be placed in each category Most likely an amphipathic Most likely an amphipathic B sheet a helix Most likely a turn/ loop Not amphipathic Asn-Leu-Ala-Asp-Ser-Phe-Arg-Gin-lle Lys-Ser-Thr-Asn-Glu-Gin-Asn-Ser-Arg Gin-lle-Thr-Phe-Thr-Leu-GIn-Val-Ser Lys-GIn-Asn-Glu-Pro-Arg-Ala-Asn-Glu Arg-Phe-GIn-lle-His-Val-Gin-Phe-Glu Ala-Phe-Leu-Val-lle-Trp-Phe-Val-Ala
5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved by trypsin? b. What are the fragments, if it is cleaved by chymotrypsin? c. What are the fragments, if it is cleaved by pepsin?
On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments based on their molecular weights. Your fellow intern Jerry has neglected to label his tubes of amyloid beta peptide 42 after digesting them with some proteases that we learned about in Module 6: pepsin, trypsin, and chymotrypsin. Help him figure out what protease is in each tube. Jerry’s supervisor has the fragments listed in the same order as the original peptide primary sequence, which...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
Need help with #2 Clearly provide the 3-letter symbol for the correct sequence of cach amino acid in each of listings of the amino acids in the peptide or in any fragments are simply listed in alphabetical order. A subscriptive the number of that amino acid. Use parentheses to incorporate the unknown amino acids after each treatment 1. A five amino acid peptide contains: Arg. Glu, His, Phe, and Ser This peptide yields the following results when broken down into...
What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe and Gly-Arg-Met 3) Ala-Val-Trp-Lys-Phe-Gly and Arg-Met - Ala-Val-Trp-Lys and Phe-Gly-Arg and Met ) Ala-Val-Trp-Lys and Phe and Gly-Arg and Met ) Ala-Val-Trp and Lys-Phe-Gly and Arg-Met Bradykinin is a nonapeptide, Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg. In addition to one mole of Arg, what peptides are present after hydrolysis of bradykinin with chymotrypsin? A) Arg-Pro-Pro and Gly-Phe and Ser-Pro-Phe B) Pro-Pro-Gly and Phe-Ser-Pro-Phe-Arg C) Arg-Pro-Pro-Gly-Phe and Ser-Pro-Phe ?) Arg-Pro-Pro-Gly-Phe-Ser...
How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide? Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu