Homework Answers
10. The correct answer is "c. Glycine". The alpha carbon of glycine has two indistinguishable hydrogen atoms unlike other amino acids.
11. The correct answer is "d".
Trypsin digests at the C-terminus of basic amino acids such as lysine and arginine when they are not followed by proline. Chemotrypsin cleaves the peptide at the C-terminus of an aromatic amino acids such as tryptophan and phenylalanine.
Add Answer to:
repulsion within the protein 10. Which of the following amino acids do not contain a chiral...
S Review View It, lea .--. . rrnalI1No Spac Heading 1 Heading 2 Title Subtitle Subtle Ern Emphas ...
s Review View It, lea .--. . rrnalI1No Spac Heading 1 Heading 2 Title Subtitle Subtle Ern Emphas Paragraph Styles 1. Explain how you would isolate a mixture of Ala-Arg-Glu using a negatively charged resin (carboxylmethyl cellulose) and a positively charged resin (DEAE). A sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were 2....
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala)...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
Based on the chemical properties of the residues, which of the following sequences could form the...
Based on the chemical properties of the residues, which of the
following sequences could form the following? At least one should
be placed in each category.
Based on the chemical properties of the residues, which of the following sequences could form the following? At least one should be placed in each category Most likely an amphipathic Most likely an amphipathic B sheet a helix Most likely a turn/ loop Not amphipathic Asn-Leu-Ala-Asp-Ser-Phe-Arg-Gin-lle Lys-Ser-Thr-Asn-Glu-Gin-Asn-Ser-Arg Gin-lle-Thr-Phe-Thr-Leu-GIn-Val-Ser Lys-GIn-Asn-Glu-Pro-Arg-Ala-Asn-Glu Arg-Phe-GIn-lle-His-Val-Gin-Phe-Glu Ala-Phe-Leu-Val-lle-Trp-Phe-Val-Ala
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
6. The following polypeptide (30 amino acids) contains a great deal of regular secondary structure. (10)...
6. The following polypeptide (30 amino acids) contains a great deal of regular secondary structure. (10) (15) (20) lys Lys Ala-Phe-Trp-Met-His- GIh-Thr-lle-Arg-Ser-Gly-Ala-Gly-Ser-Gly-Ala-Trp-Tyr-Pro-Val-Ala (30) Phe-Met-Leu-Val-Pro-Glu-Glu There are at least two regions where alpha helical structure is found. Indicate the beginning and ending residues of these regions. Any group or groups which break the alpha helical structure should not be considered part of the helix. Remember that it take four residues to give a turn of an alpha helix, so that is...
Explain this question please! Name (4 ofer to the Table of Amino Acids at the beginning of the exam to help solve this problem. Polypeptide I is a 12-mer and has the following amino acid compositi...
Explain this question please!
Name (4 ofer to the Table of Amino Acids at the beginning of the exam to help solve this problem. Polypeptide I is a 12-mer and has the following amino acid composition: Ala, Arg, 2 His, Leu, 2 Lys, 2 Phe, Ser, Thr, Trp Edman degradation of I shows that its N-terminal amino acid is His. Chymotrypsin cleavage of I yields peptide fragments A-D.Trypsin cleavage of I gives peptide fragments E-G. Shown below is the amino...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on y...
What two restriction enzymes could you use if you wanted to
produce a protein that was fused to a GST-tag that could be removed
using thrombin? Would this experimental design place any other tags
on your protein?
Here is the vector:
T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide?...
How many amino acids are there in the disease causing variant of
the Amyloid-beta (Ab) peptide?
Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu
s Review View It, lea .--. . rrnalI1No Spac Heading 1 Heading 2 Title Subtitle Subtle Ern Emphas Paragraph Styles 1. Explain how you would isolate a mixture of Ala-Arg-Glu using a negatively charged resin (carboxylmethyl cellulose) and a positively charged resin (DEAE). A sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were 2....
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
Based on the chemical properties of the residues, which of the
following sequences could form the following? At least one should
be placed in each category.
Based on the chemical properties of the residues, which of the following sequences could form the following? At least one should be placed in each category Most likely an amphipathic Most likely an amphipathic B sheet a helix Most likely a turn/ loop Not amphipathic Asn-Leu-Ala-Asp-Ser-Phe-Arg-Gin-lle Lys-Ser-Thr-Asn-Glu-Gin-Asn-Ser-Arg Gin-lle-Thr-Phe-Thr-Leu-GIn-Val-Ser Lys-GIn-Asn-Glu-Pro-Arg-Ala-Asn-Glu Arg-Phe-GIn-lle-His-Val-Gin-Phe-Glu Ala-Phe-Leu-Val-lle-Trp-Phe-Val-Ala
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
6. The following polypeptide (30 amino acids) contains a great deal of regular secondary structure. (10) (15) (20) lys Lys Ala-Phe-Trp-Met-His- GIh-Thr-lle-Arg-Ser-Gly-Ala-Gly-Ser-Gly-Ala-Trp-Tyr-Pro-Val-Ala (30) Phe-Met-Leu-Val-Pro-Glu-Glu There are at least two regions where alpha helical structure is found. Indicate the beginning and ending residues of these regions. Any group or groups which break the alpha helical structure should not be considered part of the helix. Remember that it take four residues to give a turn of an alpha helix, so that is...
Explain this question please!
Name (4 ofer to the Table of Amino Acids at the beginning of the exam to help solve this problem. Polypeptide I is a 12-mer and has the following amino acid composition: Ala, Arg, 2 His, Leu, 2 Lys, 2 Phe, Ser, Thr, Trp Edman degradation of I shows that its N-terminal amino acid is His. Chymotrypsin cleavage of I yields peptide fragments A-D.Trypsin cleavage of I gives peptide fragments E-G. Shown below is the amino...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
What two restriction enzymes could you use if you wanted to
produce a protein that was fused to a GST-tag that could be removed
using thrombin? Would this experimental design place any other tags
on your protein?
Here is the vector:
T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
How many amino acids are there in the disease causing variant of
the Amyloid-beta (Ab) peptide?
Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu
Most questions answered within 3 hours.
-
A first-time investor has found the following percentages of
stocks that are available: 30% are low...
asked 9 minutes ago -
Clean Corporation manufactures liquid window cleaner. The
following information concerns its work in process:
•
Beginning...
asked 7 minutes ago -
The following data were obtained in order to determine the
density of a cylindrical metal bar....
asked 10 minutes ago -
1. When ONE molecule of glucose is totally oxidized to
CO2 and H2O, how many net...
asked 13 minutes ago -
The probability that person A will pass Finite Mathematics is 7
8 and the probability that...
asked 28 minutes ago -
A mortgage of $200,000 is amortized over 25 years using level
payments at the end of...
asked 36 minutes ago -
Physics: Need help with inclined planes.
- Say an object is moving down an inclined plane...
asked 34 minutes ago -
Describe the process of nitrogen excretion in the body. List 4
steps and explain each step
asked 1 hour ago -
Determine the inductance of a solenoid with 670 turns in a
length of 29 cm ....
asked 52 minutes ago -
Summarize the ways through which sales and operations
planning can be integrated. Then, extend your findings...
asked 52 minutes ago -
Label the image to renview the relative resistance of various
microbes to microbial control agents
asked 1 hour ago -
PLEASE DO BOTH #5 AND #6.
The purpose of the project is to perform a timing...
asked 1 hour ago