1) ans) This is a sense astrand as it is running from 5' to 3' direction. It is the coding strand.
Expert Q&A Done 1. Is this strand the sense strand or anti-sense strand? What is your evidence (H...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
2. If a mutation occurs and alters the sequence CGATATGA to CGATATCA what will be the final effect - compared to the protein that was supposed to be made, how would the actual protein that is synthesized (made) look -shorter, longer or same? 3. Give the sequence of the protein that would result from such a mutation (mutation in question 4. What is the name given to such a mutation? Be specific (answer is not point mutation, deletion, insertion, substitution...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...
Please note that Questions 15 to 17 are connected questions. Question 15: The following shows a partial DNA sequence from the wild-type (normal) allele for the human leukemia-linked apoptotic gene. 5' ATGCGATTAATCGGTAAA 3' (non-template strand) 3' TACGCTAATTAGCCATTT 5' (template strand) Please answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence? The mRNA sequence is 5' 3'. (2 marks) 5' AUG CGA UUA AUC GGU AAA 3' ? Please enter...
You want to make E. coli bacteria that glow green. Your plan is to insert the gene for green fluorescent protein (GFP) from a jellyfish (a eukaryote) into the genome of the bacteria so that the mRNA is transcribed by the E. coli cells and translated into protein. What changes do you need to make to the jellyfish GFP gene sequence to make sure that the bacteria will make a functional protein? Why? (1 point) A type of amatoxin binds...
Extra Credit Assignment Use the Table and information below to answer the questions Second letter U C A UCA UUG/Leu บบบโphe UCU) UAUITVE UGUlays UCC Isor UAC JTyr UGC Cys Ser UUA UAA Stop UGA Stop UAG Stop UGG Trp CUU CAULHis CGU) CUC CAC CGC CUA CCA Pro CAA CGA CUG) CCG CAGS CGG СС First letter DUCUDUCUDUCUDUCU Third letter AUU AUC lle AUA AUG Met ACU ACC ACA ACG AAU? AAC AAA AAGS AGUS AGCJ AGAL AGGS GUU...
Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What do they have in common? (c) How are they different? 2. A geneticist found that a particular DNA mutation had no effect on the protein coded by a gene. What kind of mutation was this? Why? 3. (a) Name one amino acid that has more than one codon. (b) Name an amino acid that has only one codon 4. Look at the following sequence:...
1) Which of the following mutations could result in a frameshift? A) a base insertion B) a base deletion C) a base substitution D) either A or B E) A, B, and C 2) Which of the following point mutations would be most likely to result in a non-functioning protein? A) a single base substitution in an intron B) a single base deletion near the end of the coding sequence C) a single base deletion in the codon following the...