Yes DNA and proteins are smart materials due to following reasons.
1. Our cells need to divide so we can grow and re-build, but every cell needs to have the instructions. DNA gives those instructions efficiently so that a new copy of itself must be made before a cell divides.
2.DNA may be small but with properties including flexibility, replication, stability and the ability to store large amounts of data, there's a reason why it must be one of the smartest molecules.
3. DNA is very stable under several conditions, it can last for a very, very long time. This is why scientists have been able to extract and analyse DNA taken from species that have been extinct for thousands of years.
4. On the other hand, Proteins play a role in nearly every biological process, and their functions vary widely and efficiently.
5. Proteins can catalyse many biological processes and they are highly efficient.
6. Many proteins are involved in signalling process in the cell. So indeed they are very efficient and smart materials.
ll erence between Mg and Mg2) uutur 4. Would you call DNA and/or protein smart material? Why or why not? ll erence between Mg and Mg2) uutur 4. Would you call DNA and/or protein smart materia...
Microbiology: You have the following working hypothesis: To bind well to a DNA-binding protein, a DNA target site must twist less tightly and widen the narrow groove between base pairs 4 and 5. Suggest an experiment to test your hypothesis.
POST-LAB QUESTIONS 1. Based on the results of the three tests, how do you kno the fruit was DNA and not protein? Explain. 2. What happened to the egg white sample, containing mostly protein, when you heated it or oered the pH? Explain what you saw and what you think was happening at the molecular level. 3. Why does the DNA double helix unravel when exposed to high temperatures or acidic conditions? If you tried to run this experiment with...
HP1 is a DNA binding protein that interacts with a specific
sequence (TGCTTATTC). You want to analyze, by a Dnase I
footprinting assay, the effect on DNA binding of the interaction
between HP1 and its 6 binding partner PA. In each assay, you
combine a radiolabeled fragment of DNA that binds to HP1 and a
specific combination of proteins. After incubation with DNase I,
each reaction mixture was resolved by gel electrophoresis, and then
exposed to film. The autoradiogram showing...
What would be difference between the IRs of p-toluic acid (starting material) and 4- (bromomethyl)benzoic acid (product)? (You don’t need to look up the IR of p-toluic acid, just think about what is changing between the starting material and product). Why is IR not a good way to verify that you made product?
What is the relationship between protein translation and gene expression? Would you expect to always see correlation between these two? Discuss a circumstance within the context of cancer where mRNA and protein expression may not correlate. Why is it important to look at both protein and RNA levels of a series of genes/proteins in a molecular pathway? Discuss this in the context of cancer associated pathways. Give a specific example of a pathway that is independent of gene expression in...
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
Before taking this course, did you feel you would benefit from consuming more protein? Why or why not? - Based on your estimate of your current protein intake using you MyDietAnalysis 3 Day report, do you already meet or exceed the suggested protein intake for athletes indicated above? - Using an Internet search, identify at least two adverse effects to people’s health, and two adverse effects on the environment, that could result from increasing the current RDA for protein. How...
How can you use PCR in the process of generating recombinant DNA. Why would we need to add a restriction enzyme site onto a fragment of interest in the process of generating recombinant DNA? Why would you benefit from adding two different enzyme sites to a given fragment?
How would you prove that DNA is the storage molecule for genetic information? Why not proteins?