How faithfully is DNA sequence maintained from one generation to the next? What is the estimated mutation rate of an average protein/gene? How do you estimate mutation rate? What do you know about DNA...

Question

Question

How faithfully is DNA sequence maintained from one generation to the next? What is the estimated mutation rate of an average protein/gene? How do you estimate mutation rate? What do you know about DNA...

How faithfully is DNA sequence maintained from one generation to the next?

What is the estimated mutation rate of an average protein/gene?

How do you estimate mutation rate?

What do you know about DNA repair? (as a result of deamination and depurination)

science biology

Add a comment Improve this question Transcribed image text

Answer 1

Answer #1

AJA nucleotido mutation o udloot Chang pona amehow Some Se chan Tr mutation nt humans apin nucbotde qch le can estimate the musaion na amino cd murion mate ban uth out PVA supp Lose thus IN to-unlul inpnR Convension-%-a

Add a comment

Answer 2

Similar Homework Help Questions

Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...

Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
1. How would a mutation in the poly(A)-binding protein gene affect translation? How would an electron...

1. How would a mutation in the poly(A)-binding protein gene affect translation? How would an electron micrograph of polyribosomes from such a mutant differ from the normal pattern? 2. Eukaryotes have repair systems that prevent mutations due to copying errors and exposure to mutagens. What are the three excision-repair systems found in eukaryotes, and which one is responsible for correcting thymine-thymine dimers that form as a result of UV light damage to DNA? 3. What is the name given to...
Here is a DNA sequence obtained from sequencing. Does this sequence code for a gene? How can...

Here is a DNA sequence obtained from sequencing. Does this sequence code for a gene? How can you tell? Is this a eukaryotic or prokaryotic gene? How can you tell? If it does code for a gene, what is the protein sequence encoded by this DNA sequence? Explain how you can tell. Are there any regulatory regions encoded by this DNA sequence? How can you tell?TTATGTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGTTATGTTACTGACAGAGGAAGACAAAAGGTTGTTTCCATAACTGACACAACAAATCAGAAGACAGAGTTACAAGCAATTCATCTAGCTTTGCAGGATTCGGGATCAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGGATCATTCAAGCACAACCAGATAAAAGTGAATCAGAGTTAGTTAGCCAAATAATAGAGCAGTTAATAAATAAGGAAAAGATCTACCTGGCATGGGTACCAGCACATAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTTAGTGCTGGAGTCAGGAAAGTATAGTTT

Shown below is the anti-sense DNA sequence from a region of a gene that produces a...

Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...
1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA...

1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...
Next-generation sequencing involves: A. generating many short sequences from an intact, continuous DNA sequence. B. generating...

Next-generation sequencing involves: A. generating many short sequences from an intact, continuous DNA sequence. B. generating many short sequences from fragmented DNA. C. splicing together DNA fragments. D. adding multiple probes to fragmented DNA. What is the difference between a mutation and a polymorphism? A. A mutation can exist in a single person; a polymorphism must exist in at least 2% of the population. B. A mutation involves a single base pair; a polymorphism involves many base pairs. C. Mutations...

In comparing species using a protein cladogram and a DNA cladogram, how do you know which...

In comparing species using a protein cladogram and a DNA cladogram, how do you know which cladogram is correct or the most accurate? Do you think one of the cladograms is better or more reliable than the other? Why?
5. Consider the wild-type F8 gene. What would happen to the 1) transcript (mRNA) sequence and...

5. Consider the wild-type F8 gene. What would happen to the 1) transcript (mRNA) sequence and quantity, 2) to the protein (sequence, quantity, function) and 3) the person’s overall phenotype if they were homozygous (both copies of the gene are the same) for a 3 base-pair deletion in the: i. First intron ii. First exon iii. The promoter iv. 5’UTR v. Last exon 6. What environmental factor could affect the phenotype caused by an F8 null mutation? Thrombophilia is a...
What do you notice about the divergence of the amino acid (protein) sequences when compared to...

What do you notice about the divergence of the amino acid (protein) sequences when compared to the nucleotide (DNA) sequences? Given a large section of a gene, say a complete exon, how could you determine reading frame?

1. what is CRISPR gene editing? 2. what enzyme is used to cut DNA? 3.Why do...

1. what is CRISPR gene editing? 2. what enzyme is used to cut DNA? 3.Why do bacteria use CRISPR? 4.How is the enzyme targeted to a specific DNA sequence? 5.what need to be done in order to make sure the proper human protein is made in bacteria cells? 6.How can you check for proper orientation of the inserted DNA in the plasmid? 7. Why are iPSCs useful for studying hereditary neuronal diseases such as Alzheimer's. 8. How are pig cells...

How faithfully is DNA sequence maintained from one generation to the next? What is the estimated mutation rate of an average protein/gene? How do you estimate mutation rate? What do you know about DNA...

Homework Answers

Add Answer to:
How faithfully is DNA sequence maintained from one generation to the next? What is the estimated mutation rate of an average protein/gene? How do you estimate mutation rate? What do you know about DNA...

Post as a guest

Earn Coins

Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...

1. How would a mutation in the poly(A)-binding protein gene affect translation? How would an electron...

Here is a DNA sequence obtained from sequencing. Does this sequence code for a gene? How can...

Shown below is the anti-sense DNA sequence from a region of a gene that produces a...

1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA...

Next-generation sequencing involves: A. generating many short sequences from an intact, continuous DNA sequence. B. generating...

In comparing species using a protein cladogram and a DNA cladogram, how do you know which...

5. Consider the wild-type F8 gene. What would happen to the 1) transcript (mRNA) sequence and...

What do you notice about the divergence of the amino acid (protein) sequences when compared to...

1. what is CRISPR gene editing? 2. what enzyme is used to cut DNA? 3.Why do...

How faithfully is DNA sequence maintained from one generation to the next? What is the estimated mutation rate of an average protein/gene? How do you estimate mutation rate? What do you know about DNA...

Homework Answers

Add Answer to: How faithfully is DNA sequence maintained from one generation to the next? What is the estimated mutation rate of an average protein/gene? How do you estimate mutation rate? What do you know about DNA...

Post as a guest

Earn Coins

Add Answer to:
How faithfully is DNA sequence maintained from one generation to the next? What is the estimated mutation rate of an average protein/gene? How do you estimate mutation rate? What do you know about DNA...