mRNA (5'-3') is transcribed using DNA strand (3'-5') as template.
So, the sequence is complementary as per Chargaff rules.
A opposite U, T opposite A, C opposite G and G opposite C
So, answer is
3' - TACGGGAAAGTAATGGGCCAT -5'
If a mRNA had the nucleotide sequence 51-AUGCCCUUUCAUUACCCGGUA-3' Enter the sequence of the DNA from 3 to 5'. Cli...
Shown below is an mRNA sequence. Design a 15 nucleotide DNA probe to detect the mRNA using nucleic acid hybridization. 5' - AAUCGAUGGUCGAAAUGCTCGAUCAGCUAGCUAGC - 3'
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
Enter the corresponding section of mRNA produced from the following section of DNA template strand: 3' T T T G A A G C T C C A 5 Enter the nucleotide sequence using capitalized abbreviations. 5'_answer_3'
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
2. (10 pts) A portion of specific DNA molecule consists of the following sequence of nucleotide triplets. TAC GAA CTT GGG TCC This DNA sequence codes for the following short polypeptide. methionine - leucine - glutamic acid - proline - arginine Describe the steps in the synthesis of this polypeptide, and in your answer, include the mRNA sequence. What would be the effect of a deletion or an addition in one of the DNA nucleotides? What would be the effects...
What is the nucleotide order of the conplimentary mRNA? What
sequence of amino acids is coded by the DNA?
Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
“translate” the following DNA nucleotide sequence into the amino acids that would be produced from this sequence. Hint 1 – DNA must first be transcribed into messenger RNA. Hint 2 – Your ANSWER will be written in amino acids not nucleotides! TAC AAT ACA ACT
7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...
From what DNA base sequence was the following mRNA sequence transcribed? 5'-UUCGAG-3'
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...