From what DNA base sequence was the following mRNA sequence transcribed? 5'-UUCGAG-3'
From what DNA base sequence was the following mRNA sequence transcribed? 5'-UUCGAG-3'
aus: 99 Consider the following DNA sequence: TTAGATCGTAAAGTGCAATGGGATCATATG What would be the mRNA transcribed from this DNA sequence? ots)? 10 AAU CUA G CA unU CAC Gui ACC CUA GUAU- How many codons does the sequence contain 21 th A How many amino acids make up this protein? (1 pt) List the amino acids, in order, that make up this protein using the chart provided. (5 pts) Referring to the mRNA strand constructed in Question #3, list the tRNA anti-codons...
Explain why the mRNA strand is transcribed in the 5’ to 3’ direction from the DNA strand that is running in the 3’ to 5’ direction.
For each of the following DNA sequences, provide the sequence of the transcribed RNA (written from 5' to 3') and the protein translation: 1. 5'- ATGGCCCATTTTTAG-3' a. mRNA b. protein 2. 5'- ATGGCCTAGCTAAAA-3’ a. mRNA b. protein 3. 5'- TGATCAATGGCCTAG-3’ a. mRNA b. protein 4. 3º- TACGGGCTAGTTATT-5° a. mRNA b. Protein 5. Is translation an endergonic or exergonic process? Why?
DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT GA — 5’ the sequence of the MRNA is: 3’ — AGUCCGAUGGGCTGA — 5’ the sequence of the DNA strand shown above is that of the: a. template strand b. coding strand
BONUS (10 points, 2 points each): Given below is a sequence of mRNA that is transcribed from a structural and mRNA: AUG CGC GOA UCC CCC ACC AGA ACG GAX UGA-3 G-C 1. Using the codon chart provided below, write down the predicted amino acid sequence of the protein the produced from this mRNA 3-UAC GCG EXU AGG GGG UGG UCU UGC COU 2). Write down the DNA sequence of the structural pene from which this mRNA sequence is transcribed...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
Please answer this DNA question with details. Thanks
The following is the transcribed strand of DNA: GCG GCG TAC CCC AAA ATA GGG GCG CTC GCG ATT AAA CCG TTC CCC What is the untranscribed strand? What is the mRNA sequence that would be transcribed from the transcribed strand? What is the sequence of tRNA nucleotides that would match up with the mRNA? What is the amino acid sequence that would result from translation of the mRNA?
The following DNA sequence encodes the beginning of the protein 5’ ATGCTAGCCCTAGCTGATAACATTCTACGTATAATAAATTTCCTA 3’ #1 Write the mRNA sequence of this stretch of DNA. (how it would read if this gene would be transcribed) #2 Write the protein sequence in single letter code that corresponds to the mRNA sequence.
dar Use the following DNA sequence to transcribe into the mRNA: 5'AAATGC3' (So what is the mRNA from this): 3.....5 12pt Paragraph O words </> P