ANSWER:
Here the DNA sequence given is :- 5IAAATGC 3I
The mRNA strand for the given DNA sequence is:- 3I UUUACG 5I
Explanation;
Here in the given DNA strand contains the purines and pyrimidines and they are the nitrogen bases which holds the strand as strong. And the Adenine and Guanine, the purines which bonds with the Thymine( in DNA ) or Uracil ( in RNA ) and with the Cytosine ( both in RNA & DNA). In the given strand Adenine bonds with Uracil and Thymine bonds with Adenine. The Guanine bonds with Cytosine and vice versa.
dar Use the following DNA sequence to transcribe into the mRNA: 5'AAATGC3' (So what is the...
Transcribe the DNA sequence into the mRNA sequence and label its 5' and 3' ends. 3 - TAC AAA GAG GAT CCG ACC TCA ACT - 5 What is the full name (extended version, like discussed in the lecture) of the enzyme that performs this process?
Transcribe the DNA sequence below: translate the mRNA sequence below:
Transcribe the following DNA sequence into mRNA, and then translate it into protein. Be sure to figure out where translation would start, and where it would stop. DNA GGCTATACCGGTTACCGATAATTGGCTATCTG RNA: Protein:
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG TTTCAG GGG TTAGGC GCGAAATGCATC mRNA: Protein: b) What happens if I insert an "A" at the 9* nucleotide position in the original sequence given? What is the protein message now? modified DNA: mRNA: Protein: c) Which enzyme was used during transcription? What is the machinery/organelle responsible for building the protein? I
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
From what DNA base sequence was the following mRNA sequence transcribed? 5'-UUCGAG-3'
Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into its corresponding protein (USING SINGLE LETTER ABBREVIATIONS of the amino acids), and 3) determine the protein sequence if you had a DELETION mutation of the emboldened thymine. 3’ 5’ TCGGCGTGTACTACTACACGGTATATACGTTTCTTTTGATTAGCCGCTT
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3' 3' CGCTACTTTGCGGGCTGCATCCCG 5'
This DNA sequence represents an open reading frame (ORF) of a transcriptional unit. Transcribe and then translate this gene in the spaces provided below. 5' ATGGGAGCTGTTGTATTTGA 3' 3' TACCCTCGAGCAACATAAACT 5' Transcribe mRNA sequence and translated protein sequence.
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence