Shown below is an mRNA sequence. Design a 15 nucleotide DNA probe to detect the mRNA...
Shown below is an mRNA sequence. Design a 15 nucleotide DNA probe to detect the mRNA using nucleic acid hybridization.
5' - AAUCGAUGGUCGAAAUGCTCGAUCAGCUAGCUAGC - 3'
Homework Answers
Nucleic acid hybridization is a technique of visualisation of specific sequence of nucleic acid using a complementary nucleic acid probe. The complementary nucleic acid probe binds to the specific sequence of nucleic acid and give either fluorescence or radioactivity which helps us to determine its location.
So, in this case the DNA will be complementary and antiparallel to the given RNA molecule.
You can design the probe by taking any 15 bases into consideration.
DNA probe : 3' TTAGCTACCAGCTTT 5' (the probe is desgined using the first 15 bases)
Please rate high.
Add Answer to:
Shown below is an mRNA sequence. Design a 15 nucleotide DNA
probe to detect the mRNA...
1. DNA Structure and Replication fill in the blanks. 10pts and , have two nitrogenous rings...
1. DNA Structure and Replication fill in the blanks. 10pts and , have two nitrogenous rings and are a. The bases, called direction and reads the b. DNA Polymerase synthesizes new DNA in the template DNA strand in the direction. c. DNA polymerases use -exonuclease activity to proofread newly synthesized DNA. Whereas, DNA Pol I uses _-exonuclease activity to remove RNA primers. d. The enzyme telomerase synthesizes using as a template. e. DNA Replication begins at the and two ,,...
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
If a mRNA had the nucleotide sequence 51-AUGCCCUUUCAUUACCCGGUA-3' Enter the sequence of the DNA from 3 to 5'. Cli...
If a mRNA had the nucleotide sequence 51-AUGCCCUUUCAUUACCCGGUA-3' Enter the sequence of the DNA from 3 to 5'. Click in the answer box to activate the palette. 3- ATGGCCCATTACTTTCCCGTA -5' Only enter the letters representing the nucleotides.
What is the nucleotide order of the conplimentary mRNA? What sequence of amino acids is coded...
What is the nucleotide order of the conplimentary mRNA? What
sequence of amino acids is coded by the DNA?
Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
.Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A...
.Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A T A T T G T C A. T A G T A C A A G A B. C G A T A T T G T C C. G T C A A G A C C T D G C T A T A A C A G Select the strand of RNA that is complementary to this single strand of...
What is the proper nucleotide sequence for the new mRNA strand based upon the nucleotide sequence...
What is the proper nucleotide sequence for the new mRNA strand based upon the nucleotide sequence provided in the old DNA strand. Old Strand: ATGGCTTAAGCCT O UACCGAAUUCGGA TACCGAATTCGGA O CGTTAGGCCTAAG CGTTUGGCCTUUG
B. Below is the part of the DNA sequence of the lacZ gene from the(+180 to...
B. Below is the part of the DNA sequence of the lacZ gene from the(+180 to +210 base pair position. Design a DNA probe that would bind complimentary to the lacZ mRNA from the +195 to +210 base pair position (4pts) CCA +180 +195 +210 5' CTTTGCCTGGTTTCCGGCACCAGAAGCGGT 3' probe: FCGG5
a piece of eukaryotic DNA is shown below: 5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA...
a piece of eukaryotic DNA is shown below: 5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA PRODCUED, IF THIS IS THE CODING STRAND? b)Assuming that after processing, a cap is added to the mRNA at the 5’ end, predict the amino-acid sequence of the protein produced from this piece of mRNA using SINGLE LETTER codes. In your answer denote both the amino and carboxy ends of the protein? THANKS FOR THE HELP.
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of...
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-Thr-Lys-Gly).
1. DNA Structure and Replication fill in the blanks. 10pts and , have two nitrogenous rings and are a. The bases, called direction and reads the b. DNA Polymerase synthesizes new DNA in the template DNA strand in the direction. c. DNA polymerases use -exonuclease activity to proofread newly synthesized DNA. Whereas, DNA Pol I uses _-exonuclease activity to remove RNA primers. d. The enzyme telomerase synthesizes using as a template. e. DNA Replication begins at the and two ,,...
If a mRNA had the nucleotide sequence 51-AUGCCCUUUCAUUACCCGGUA-3' Enter the sequence of the DNA from 3 to 5'. Click in the answer box to activate the palette. 3- ATGGCCCATTACTTTCCCGTA -5' Only enter the letters representing the nucleotides.
What is the nucleotide order of the conplimentary mRNA? What
sequence of amino acids is coded by the DNA?
Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
What is the proper nucleotide sequence for the new mRNA strand based upon the nucleotide sequence provided in the old DNA strand. Old Strand: ATGGCTTAAGCCT O UACCGAAUUCGGA TACCGAATTCGGA O CGTTAGGCCTAAG CGTTUGGCCTUUG
B. Below is the part of the DNA sequence of the lacZ gene from the(+180 to +210 base pair position. Design a DNA probe that would bind complimentary to the lacZ mRNA from the +195 to +210 base pair position (4pts) CCA +180 +195 +210 5' CTTTGCCTGGTTTCCGGCACCAGAAGCGGT 3' probe: FCGG5
Most questions answered within 3 hours.
-
Assume one of your finals has 50 questions on it, and
lucky for you, it's all...
asked 33 minutes ago -
Rice Products in Bangladesh
Business behavior is derived in large part from the basic cultural
environment...
asked 1 hour ago -
The following base sequence is found for a mRNA fragment from
wild-type E. coli: 5'- UAUCAGUAGAUAAUGUAACC-3'...
asked 2 hours ago -
For this exercise, round all regression parameters to three
decimal places.
One of the two tables...
asked 2 hours ago -
What is the 5% level of significance for mean = 3.60, standard
deviation = 0.94, and...
asked 2 hours ago -
Prior to beginning work on this discussion, please read the
article by Hayley Peterson, 15 Companies...
asked 3 hours ago -
Which pair of aqueous solutions, when mixed, will form a
precipitate?
A) NaNO3 and AgC2H3O2
B)...
asked 3 hours ago -
1-Write an algorithm to get two numbers from the user (as
inputs) and calculate the sum...
asked 6 hours ago -
Define white-collar crime. What is the difference between
offender and offense-based definitions of white-collar crime? What...
asked 7 hours ago -
Consider a reaction which is 1st order with respect to A and 1st
order with respect...
asked 7 hours ago -
c++
The length of the hypotenuse of a right-angled triangle is the
square root of the...
asked 7 hours ago -
When a metal rod is heated, not only its resistance but also its
length and cross‐sectional...
asked 7 hours ago