What is the proper nucleotide sequence for the new mRNA strand based upon the nucleotide sequence...

Question

Question

Answer 1

Answer #1

Answer:

UACCGAAUUCGGA

Explanation:

DNA (A) = (U) mRNA

DNA (T) = (A) mRNA

DNA (G) = (C) mRNA

DNA (C) = (G) mRNA

Answer 2

Similar Homework Help Questions

What is the nucleotide order of the conplimentary mRNA? What sequence of amino acids is coded...

What is the nucleotide order of the conplimentary mRNA? What sequence of amino acids is coded by the DNA? Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...

1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...

In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)

6/q /4925530/take REFEBERHETERRE AGAGGGGTTACCGGGGATTGTAGACTTCTCS a) Using the DNA sequence provided (note: only the coding strand is...

6/q /4925530/take REFEBERHETERRE AGAGGGGTTACCGGGGATTGTAGACTTCTCS a) Using the DNA sequence provided (note: only the coding strand is provided) transcribe the sequence into mRNA. Assume transcription starts at the first nucleotide of the provided sequence that is, the promoter region is not shown). b) Translate the mRNA strand from part a to the correct amino acid sequence The codon chart is provided BIANIE BSN
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...

Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?

1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?

1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino...

1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino acid sequence of the protein that will be found in each of the following mutations. Please also list an anticipated phenotypical change(s) (nonsense, missense, frameshift, addition/subtraction of amino acid etc.) (1 pts each) Second position Nucleotide #: 1 4 7 10 13 U UUU 16 19 22 UCU UAU UGU UUC UAC UAA UUA UUD RNA: 5-AUG ACC GGC AAU CAA CUA UAU UGA-3'...
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and...

You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence
Assuming you have this strand: 3’-TGAATC-5’ What would be the: a) Complementary strand b) mRNA strand...

Assuming you have this strand: 3’-TGAATC-5’ What would be the: a) Complementary strand b) mRNA strand c) nucleotide tRNA sequence

Shown below is an mRNA sequence. Design a 15 nucleotide DNA probe to detect the mRNA...

Shown below is an mRNA sequence. Design a 15 nucleotide DNA probe to detect the mRNA using nucleic acid hybridization. 5' - AAUCGAUGGUCGAAAUGCTCGAUCAGCUAGCUAGC - 3'