Homework Answers
RNA polymerase enzyme will transcribe in 5'>3' direction. so the mRNA in this case will be produced from the complementary strand of the given DNA sequence. The lacZ mRNA from +195 to +210 will be,
5'- CGGCACCAGAAGCGGU -3'
A DNA probe is a fragment of DNA of variable length which will be radioactively or fluorescently labelled and complementary to its target nucleotide sequence. So the DNA probe complementary for this mRNA would be ,
3'- GCCGTGGTCTTCGCCA -5'
Add Answer to:
B. Below is the part of the DNA sequence of the lacZ gene from the(+180 to...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
The transcribed portion of a DNA sequence for a gene is shown below
The transcribed portion of a DNA sequence for a gene is shown below. Identify the mRNA sequence and the polypeptide sequence that would be produced from this gene. Also, identify the specific type of DNA mutation and protein mutation that would result if the underlined A/T basepair was mutated to a C/G basepair. NOTE: Assume RNA polymerase is moving left to right across the page. 3' - TATACGCGATATGGATTC - 5 5'- ATATGCGCTATACCTAAG - 3
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005
Shown below is an mRNA sequence. Design a 15 nucleotide DNA probe to detect the mRNA...
Shown below is an mRNA sequence. Design a 15 nucleotide DNA probe to detect the mRNA using nucleic acid hybridization. 5' - AAUCGAUGGUCGAAAUGCTCGAUCAGCUAGCUAGC - 3'
Can someone outline how I would go from my DNA sequence to my final product of...
Can someone outline how I would go from my DNA sequence to my
final product of coding the amino acids. I am confused on the
complimenting strands and which ones I would need.
Below is the coding sequence of very small prokaryotic gene. The coding sequence is shown in red while the regulatory sequences are shown in black and the UTR in blue. The underlined sequences denote the -10 sequence. The arrow marks the point of a 5 base insertion...
Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a...
Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a specific protein. Write the DNA leading strain sequence, complimentary lagging stain sequence, and the protein with the amino acid sequence. Use the Codon Table provided. The mRNA transcript is provided for you. Leading strain : 5’ Lagging strain: 3’ mRNA transcript:5’ AUG UAC UAG GGC CCA AUU GAA ACG GGG ACC CCA GCC UGA3’ protein amino acid:
If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of...
If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of the corresponding mRNA? (Note: "..." represents an intervening sequence) a. 3 CAG...GGU S' b. 5'CAG.GGU-3 OCCAGGGT-3 O d. 5'-GUC...CCA-5 Oe.3GUC...CCAS'
table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are...
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Can someone outline how I would go from my DNA sequence to my
final product of coding the amino acids. I am confused on the
complimenting strands and which ones I would need.
Below is the coding sequence of very small prokaryotic gene. The coding sequence is shown in red while the regulatory sequences are shown in black and the UTR in blue. The underlined sequences denote the -10 sequence. The arrow marks the point of a 5 base insertion...
If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of the corresponding mRNA? (Note: "..." represents an intervening sequence) a. 3 CAG...GGU S' b. 5'CAG.GGU-3 OCCAGGGT-3 O d. 5'-GUC...CCA-5 Oe.3GUC...CCAS'
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
Most questions answered within 3 hours.
-
Write a program to solve the Josephus problem, with the following
modification:
Sample Input:
./a.out n...
asked 2 hours ago -
At the start of a CD it is spinning at a rate of 525 rpm
(revolutions...
asked 2 hours ago -
4. Without doing any calculations, predict whether the observed
∆T would increase, decrease or remain the...
asked 3 hours ago -
Based on the range, which of the following sets of scores has
the greatest variability? 3,...
asked 4 hours ago -
Ripples in a pond travel at a velocity of 3 m/s with one peak
passing a...
asked 4 hours ago -
A man stands on the roof of a building of height 13.0 mm and
throws a...
asked 4 hours ago -
The extent to which assets are financed by borrowed funds and
other liabilities is indicated by:...
asked 5 hours ago -
Explain in detail
Germany is the fifth largest economy
explain what goods and services Germany specializes...
asked 6 hours ago -
The density of platinum is 21.45 g/mL. If a cube of platinum
with a mass of...
asked 6 hours ago -
Accounts Receivable
Sales
A/R Posting
Extended Sales Invoice
Packing Slip
Compare invoice to packing slip 2...
asked 6 hours ago -
Michaella, age 23, is a full-time law student and is claimed by
her parents as a...
asked 6 hours ago -
Why are polymers not typically casted into products?
asked 6 hours ago