The following data were obtained from partial cleavage and analysis of a pentadecapeptide. Determine the sequence of the pentadecapeptide. Use three-letter abbreviations in your answer. Please explain thoroughly, step by step.
Homework Answers
Trypsin cuts chain on the right(carboxylic acid) side of any basic amino acid ...(lys,arg) .
Chimotrypsin cuts chain on the right(carboxylic acid) side of any aromatic amino acid ...(phe,trp,hys,tyr) .
CnBr cuts chain on the right(carboxylic acid) side of metheonine .
Based on these information , we can predict the sequence . That will be ,
Phe- Trp-Met-Gly-Ala-Lys-Leu-Pro-Met-Asp-Gly-Arg-Cys-Ala-Gln
Add Answer to:
The following data were obtained from partial cleavage and analysis of a pentadecapeptide. Determine the sequence of the...
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide?...
How many amino acids are there in the disease causing variant of
the Amyloid-beta (Ab) peptide?
Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu
Indicate the peptides that would result from cleavage by the indicated reagent: Gly-Lys-Leu-Ala-Cys-Arg-Ala-Phe by trypsin Enter...
Indicate the peptides that would result from cleavage by the indicated reagent: Gly-Lys-Leu-Ala-Cys-Arg-Ala-Phe by trypsin Enter your answers in respective order separated by commas. Phe-Pro-Tyr-Gly-Val-Met by chymotrypsin Enter your answers in respective order separated by comma.
What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe...
What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe and Gly-Arg-Met 3) Ala-Val-Trp-Lys-Phe-Gly and Arg-Met - Ala-Val-Trp-Lys and Phe-Gly-Arg and Met ) Ala-Val-Trp-Lys and Phe and Gly-Arg and Met ) Ala-Val-Trp and Lys-Phe-Gly and Arg-Met Bradykinin is a nonapeptide, Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg. In addition to one mole of Arg, what peptides are present after hydrolysis of bradykinin with chymotrypsin? A) Arg-Pro-Pro and Gly-Phe and Ser-Pro-Phe B) Pro-Pro-Gly and Phe-Ser-Pro-Phe-Arg C) Arg-Pro-Pro-Gly-Phe and Ser-Pro-Phe ?) Arg-Pro-Pro-Gly-Phe-Ser...
5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved...
5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved by trypsin? b. What are the fragments, if it is cleaved by chymotrypsin? c. What are the fragments, if it is cleaved by pepsin?
What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on y...
What two restriction enzymes could you use if you wanted to
produce a protein that was fused to a GST-tag that could be removed
using thrombin? Would this experimental design place any other tags
on your protein?
Here is the vector:
T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
Which of these protein sequences is most likely to span a cell membrane? Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-I
Which of these protein sequences is most likely to span a cell
membrane?
Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-Ile-Asn-ser-Ile-Asn-Phe-Asp-Asn-Pro-Val-Tyr-Gln A. 773 B. 792 C. 811
anyone can help me with it? A protein biochemist attempted to determine the amino acid sequence...
anyone can help me with it?
A protein biochemist attempted to determine the amino acid sequence of a decapeptide. Use the results from the trypsin, chymotrypsin, and cyanogen bromide treatments to suggest the amino acid sequence of this decapeptide. Trypsin digestion gave two fragments with multiple residues (not in order): • T1: Ala, Arg, Phe, Gly, Thr, Trp, Tyr • T2: Lys, Met, Val Chymotrypsin digestion gave four fragments with multiple residues (not in order): • CT1: Ala, Phe •...
i think there are two right answers? From the partial nucleotide sequence given below, what peptides could be encoded?...
i think there are two right answers?
From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
The next DNA sequence is the MATRICE strand of a small gene. What is the complete...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
How many amino acids are there in the disease causing variant of
the Amyloid-beta (Ab) peptide?
Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu
What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe and Gly-Arg-Met 3) Ala-Val-Trp-Lys-Phe-Gly and Arg-Met - Ala-Val-Trp-Lys and Phe-Gly-Arg and Met ) Ala-Val-Trp-Lys and Phe and Gly-Arg and Met ) Ala-Val-Trp and Lys-Phe-Gly and Arg-Met Bradykinin is a nonapeptide, Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg. In addition to one mole of Arg, what peptides are present after hydrolysis of bradykinin with chymotrypsin? A) Arg-Pro-Pro and Gly-Phe and Ser-Pro-Phe B) Pro-Pro-Gly and Phe-Ser-Pro-Phe-Arg C) Arg-Pro-Pro-Gly-Phe and Ser-Pro-Phe ?) Arg-Pro-Pro-Gly-Phe-Ser...
5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved by trypsin? b. What are the fragments, if it is cleaved by chymotrypsin? c. What are the fragments, if it is cleaved by pepsin?
What two restriction enzymes could you use if you wanted to
produce a protein that was fused to a GST-tag that could be removed
using thrombin? Would this experimental design place any other tags
on your protein?
Here is the vector:
T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
Which of these protein sequences is most likely to span a cell
membrane?
Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-Ile-Asn-ser-Ile-Asn-Phe-Asp-Asn-Pro-Val-Tyr-Gln A. 773 B. 792 C. 811
anyone can help me with it?
A protein biochemist attempted to determine the amino acid sequence of a decapeptide. Use the results from the trypsin, chymotrypsin, and cyanogen bromide treatments to suggest the amino acid sequence of this decapeptide. Trypsin digestion gave two fragments with multiple residues (not in order): • T1: Ala, Arg, Phe, Gly, Thr, Trp, Tyr • T2: Lys, Met, Val Chymotrypsin digestion gave four fragments with multiple residues (not in order): • CT1: Ala, Phe •...
i think there are two right answers?
From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
Most questions answered within 3 hours.
-
Complete and balance the following methesis reaction in aqueous
solution.
Instructions
• Use proper element capitalization....
asked 1 minute ago -
Please read the article attached.Under Armour Is Subject of
Federal Accounting Probes - WSJ.pdf Under Armour,...
asked 3 minutes ago -
A face value of $10,000 is assumed for these Treasury bills.
Maturity Days to Maturity Bank...
asked 6 minutes ago -
An increase in income will usually shift out the demand for a
product.
Group of answer...
asked 7 minutes ago -
Green Tree Corporation is expecting to receive $0.5 million at
the end of Year 1, $0.25...
asked 10 minutes ago -
What is the correct unit of the spring constant k?
A- N m
B- J/m
C-...
asked 18 minutes ago -
A manufacturing company prepays its insurance coverage for a
three-year period. The premium for the three...
asked 22 minutes ago -
What is the other name for Shortest Job First Preemptive
Algorithm?
What are the 5 different...
asked 35 minutes ago -
24) An outbreak due to exposure of a group of persons to the
same harmful influence...
asked 44 minutes ago -
Show the calculation of (1) the expected grams of alum
(KAl(SO4)2 •12 H2O) formed from the...
asked 47 minutes ago -
*There are two different answers posted. Other students
were asked the same question. Which response is...
asked 1 hour ago -
Data is collected on the relationship between time spent playing
video games and time spent with...
asked 1 hour ago