9. At what point (timing in the sequence) is the frequency encoding gradient turned on?
8. At what point (timing in the sequence) is the phase encoding gradient turned on?
You wish to produce an image with a 4 cm FOV and 512 phase encoding gradient steps. The maximum phase encoding gradient you can produce is 2 G/cm. What should the width of the phase encoding gradient be?
You are working with a 3 T MRI scanner with maximum gradient strength of 40 mT/m in all 3 axes (x,y,z). Your acquisition uses maximum gradient strength to minimize the duration of the data acquisition window. When the Gx is the only gradient that is turned on, what is the rotation frequency for spins located at x=5cm, y=5cm? The gyromagnetic ratio is γ=42.576 MHz/T
hi I need help with these questions please
q1 How long is the DNA sequence encoding the protein that
confers ampicillin resistance (in bp units)? Input one number only,
with no spaces or units. (1 mark)
q2 How long is the DNA sequence encoding the protein that
confers hygromycin resistance (in bp units)? Input one number only,
with no spaces or units. (1 mark)
q3 What is the size of the OTC-Δ DNA sequence that has been
inserted into the...
Suppose that a mutation occurs in an intron of a gene encoding a protein. Explain what effect this mutation will have on the protein’s amino acid sequence?
. Huffman Encoding (a.) (6 points) Suppose a certain file contains only the following letters with the corresponding frequencies 1 AİB 73 9 30 44 130 28 16 In a fixed-length encoding scheme, cach character is given a binary representation with the same number of bits. What is the minimum number of bits required to represent each letter of this file under fixed-length encoding scheme? Describe how to encode all seven letters in this file using the number of bits...
6-bit floating-point encoding: 1 sign bit, 3 exponent bits, 2 frac bits( mantissa/significand) what is the exact 6-bit floating-point encoding for the following numbers: 17 0.5 -6 7.5 Please show the steps
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...
4-9. The dominant mode TEio is propagated in a rectangular waveguide of dimensions a 2.25 cm and b-l cm. Assume an air dielectric with a breakdown gradient of 30 kV/cm and a frequency of 10 GHz. There are no standing waves in the guide. De- termine the maximum average power that can be carried by the guide
4-9. The dominant mode TEio is propagated in a rectangular waveguide of dimensions a 2.25 cm and b-l cm. Assume an air dielectric...