(Gf) The phase encoding gradient is a magnetic field gradient that allows the encoding of the spatial signal location along a second dimension by different spin phases. The phase encoding gradient is applied after slice selection and excitation (before the frequency encoding gradient), orthogonally to the other two gradients. The spatial resolution is directly related to the number of phase encoding steps (gradients).
A phase encoding gradient is applied between the 90° and 180° pulses. Means it starts from at T/4 to T/2
8. At what point (timing in the sequence) is the phase encoding gradient turned on?
9. At what point (timing in the sequence) is the frequency encoding gradient turned on?
You wish to produce an image with a 4 cm FOV and 512 phase encoding gradient steps. The maximum phase encoding gradient you can produce is 2 G/cm. What should the width of the phase encoding gradient be?
hi I need help with these questions please
q1 How long is the DNA sequence encoding the protein that
confers ampicillin resistance (in bp units)? Input one number only,
with no spaces or units. (1 mark)
q2 How long is the DNA sequence encoding the protein that
confers hygromycin resistance (in bp units)? Input one number only,
with no spaces or units. (1 mark)
q3 What is the size of the OTC-Δ DNA sequence that has been
inserted into the...
Suppose that a mutation occurs in an intron of a gene encoding a protein. Explain what effect this mutation will have on the protein’s amino acid sequence?
6-bit floating-point encoding: 1 sign bit, 3 exponent bits, 2 frac bits( mantissa/significand) what is the exact 6-bit floating-point encoding for the following numbers: 17 0.5 -6 7.5 Please show the steps
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...
Edgar turned on his brother’s computer and it does not start. He reported hearing and sequence of beeps at start, 10 or 20 approximately. What is the cause of the problem? What can be done to make the computer start? Mention two potential solutions.
A three-phase system is in "abc" sequence with a wye-connected load, and one phase voltage is given by ?AN = 60V?40° . What is the line voltage ?CA ?
Question 8 (1 point) When does a concentration gradient exist? when solute concentrations are high when solute concentrations are low when membranes rupture when solute concentrations differ on the two sides of a membrane