Select one of the inherited or acquired disorders of hemostasis and perform an internet search for a recent news article focusing on that disease. Be sure to select an actual news article, not a scientific study, encyclopedia page, or research journal article. The best way to do this is to do a Google news search for the specific disorder. The article should be published within the last year. Once you have selected a news article, write one paragraph summary of its contents along with a web link back to the original source. Be sure to put your summary in your own words and include a specific link to the article.
This article is published in Hemophilia news Today, based on a potential gene therapy for curing Hemophilia A. This therapy would prove to be useful for a patient population excluded from gene therapy approaches. AMT-180 has an ability to bypass inhibitors to FV111 in preclinical studies and maybe beneficial for patient population who have been excluded from gene therapy approaches The company is also focusing a gene therapy for Hemophilia B as well as for Fabry disease, the company is developing AMT-190 and AMT-150. The article shows the company uniQure advancements in introducing new gene therapy for the cause.
Select one of the inherited or acquired disorders of hemostasis and perform an internet search for...
Essay for RSS Feeds Select two articles from the RSS feed, one that details a concern related to the previous modules and one that explains a new technology or service. Summarize each article and include a concluding paragraph that explains how you as a working professional would use this information. Scan the articles that appeared over the last two weeks. Use those articles to create your own one-page summary of significant innovations or concerns over the last two weeks and...
Then, search the Internet, like on Google or Bing, and put Gender and Diversity in the Workplace in the Search Box. Search and select the articles you want to use for this paper. (Note: Do not use information from BLOGS or from Wikipedia for your paper; these are open-source and the information cannot be validated as accurate.) Gender and Diversity in the Workplace The role of gender and ethnicity can shed light on how individuals react within a group. Use...
Using the Internet as a research tool, select one latest case study from the IT industry, wherein the ethics were compromised to a considerable extent. Based on the selected case study, do reflective writing (at least 250 words). Your writing must include the following: 1. summary of the selected case study (i.e., from the IT industry) – 5 Marks 2. specify as to which ethical values were ignored/compromised in the context of the selected case study – 10 Marks 3....
dentify the top 3 foods from your grocery basket that might be containing GMOs (from the categories: definitely containing; likely containing and Not sure if containing) and list them in a table similar to the one below*. (You can download a template here or create your own) For each of the three products you selected, complete the applicable table columns. Assume that the ingredient is GMO and conduct research to find if there are any health, environmental, or other types...
Cell Organelle Disease Booklet You are probably familiar with many genetic disorders and maybe even the symptoms that people show with these disorders but have you ever thought about how diseases occur at a cellular level? Recall that living things are organized with organ systems made of organs, organs made of tissues, and tissues made of cells, and cells made of organelles. With this in mind then it makes sense that many inherited diseases lead back to malfunctions in the...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
This assignment is due 2/25 and is worth 50 points Opinion Paper and Comparative Critique: Print Media and Website Information Objective: This assignment will test your ability to critically analyze popular media nutrition information, according to its content, whether you think the information is valid and/or accurate based on the principles you are learning from the course. This will help you to integrate and apply knowledge from class materials and/or relevant personal experiences. ______________________________________________________________________________________________________ Instructions: Note: This is one assignment...
Project: Mendelian Traits (Biological Anthropology) Guidelines Create a visual presentation about a specific trait (a birth mark, body feature, genetic disorder, or disease) considered Mendelian. That is, select an inherited trait that is governed by a single allele or location in a gene. Some of these can be disorders that include sickle-ell anemia, lactose intolerance, high blood pressure, certain types of dwarfism, and Tay-Sachs disease. In other instances it can just be a birth mark, feature of the body (such...
Can anyone pick one and give me an example? This Internet assignment consists of four choices. Choose two of the four choices that you would like to learn more about. Each chosen part of this Internet assignment is worth a possible 20 points. So, the Internet assignment is worth a total of 40 possible points (20 points for each choice you have selected and written about). Your response to each chosen assignment should be a minimum of 10 complete sentences. ...
you can get this Mining Big Data: Current Status, and Forecast to the Future pdf in the google search. this one is the article by Wei Fan Lab Instructions: Read the articles enclosed with this assignment; Mining Big Data For each article, write a minimum of paragraphs. paragraph should provide you opinion of the article. Paragraphs should be approximately 4-8 sentences each. Do not plagiarize from the articles provided. All work should be your own. Submit your work as a...