DNA code as
TTT TCT TAT TGT
replacing Thymidine with Uridine read as same RNA codons
A silent mutation is one that does not affect polypeptide structure. Write a code for an...
*Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift - Insertion Point - Nonsense Frameshift Deletion Point - Silent Original DNA Sequence: TACACCTTGGCGACT mRNA Sequence: AUG Amino Acid Sequence: Mutated DNA Sequence #1: TACATCTTGGCGACT What's the mRNA sequence? (Circle the change) AUG TALAALLA What will be the amino acid sequence? Will there likely be effects?_ What kind of mutation is this? Mutated DNA Sequence 12: TACGAC CTTGGCGACT What's the mRNA sequence? (Circle the change)...
How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
en the letters write your answer as one word. Do not include the word STOP for the stop codon For Item D: Draw the correct structure for the peptide on Part C. You can write the polypeptide as a condensed structure or as a skeletal structure Given the following single stranded DNA (coding strand answer the following questions 5-AAT ATG TAC GAC AAC GCC TAG AGG 3 a) (Ipt) What is the complementary strand (template strand; 3'-5" direction) for the...
2. A substitution mutation is one in which one nucleotide base is changed to another Suggest ONE substitution A G mutation in the DNA that would cause the first amino acid in the "# of Eyes" gene to change from alanine (Ala) to valine (Val). In the table below, write the original.3. There is a substitution mutation in the gene for Fangs in which the first DNA base changes from guanine to thymine. The mutation results in a genetic disorder...
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...
1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...
QUESTION 49 A type of mutation that does not alter the amino acid sequence of a polypeptide even though the nucleotide sequence has been changed. Induced mutation Nonsense mutation Silent mutation Missense mutation None of the above 2 points QUESTION 50 Which of the following is an example of DNA damage? Loss of the helix structure of the DNA. A single break in the backbone...
Name (PRINT) 25. Codon degeneracy means There is a redundancy of the genetic code. Silent mutation is possible. c. Occurs at the third position of the genetic code. d. All of the above a. b 26. The F factor is passed from a F+ to a F- cell during: a. Binary fission. b. Standard double strand DNA replication. c. Homologous recombination. d. Rolling-circle replication. 27. The main difference between a F cell and a Hfr cell is that in Hfr...