Question

A substitution mutation is one in which one nucleotide base is changed to another

image.png

2. A substitution mutation is one in which one nucleotide base is changed to another Suggest ONE substitution A G mutation in the DNA that would cause the first amino acid in the "# of Eyes" gene to change from alanine (Ala) to valine (Val). In the table below, write the original.

image.png

3. There is a substitution mutation in the gene for Fangs in which the first DNA base changes from guanine to thymine. The mutation results in a genetic disorder in which the monster's teeth and gums undergo decay and are highly susceptible to bacterial infection. 

a. Describe how this DNA mutation affects/changes the amino acid sequence in the polypeptide. Be specific! 

b. Explain how/why a change in the amino acid sequence of a polypeptide due to a gene mutation can lead to a genetic disorder in an organism.

1 0
Add a comment Improve this question Transcribed image text
Answer #1

2:

Original

Mutation

DNA

CGT

CAT

mRNA

GCA

GUA

Amino acid

Alanine

Valine

3 (a) : Mutation that alters a single nucleotide is termed as point mutation. Since only one nucleotide that is Guanine is changed to Thymine, it is an example of point mutation.

Mutation in DNA will alter the sequence of mRNA. Since mRNA takes part in protein formation (translation) its sequence will also get affected. This will lead to the synthesis of altered / incomplete proteins, and that can lead to disease.

Mutation in DNA --------> Change in the sequence of nucleotide in mRNA -----------> Effect on amino acid sequence ----------> Altered Protein

Proteins are built from 20 buliding blocks, called amino acids.

b: If progeny are to have a good chances at survival, DNA sequence from parents must be passed on largely unchanged. So if there is any mutation in gene of parent it will pass onto the next generation causing genetic disorder.

Add a comment
Know the answer?
Add Answer to:
A substitution mutation is one in which one nucleotide base is changed to another
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

  • What are the three functional groups that comprise a nucleotide? What do nucleotides have in common...

    What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...

  • Due to a recessive mutation in gene A, amino acid ‘Glu’ in position 25 of polypeptide...

    Due to a recessive mutation in gene A, amino acid ‘Glu’ in position 25 of polypeptide A (the wild polypeptide) is replaced by ‘Ala’. Individuals who are homozygous for the mutant allele (aa) don’t have any phenotypic alterations. Based on this observation, which of the following IS TRUE? A. The mutation has occurred in the promoter. B. The mutation has occurred in one of the introns of the encoding gene. C. The mutation was a base substitution in one of...

  • Review Questions BIOL 260: Chapters 8-10, 13, 19 1. Consider a mutation involving the deletion of...

    Review Questions BIOL 260: Chapters 8-10, 13, 19 1. Consider a mutation involving the deletion of either 1, 2, or 3 nucleotides in the DNA of a bacterium. Which of these mutations (ie., deletion of 1, 2, or 3 nucleotides) would likely have the LEAST impact on the organism? Why? Include in your answer a comparison with the other two options to justify your reasoning. Think carefully about the impact each mutation would have on the ultimate protein coded for...

  • DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...

    DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...

  • Question 5 (20 points) Make a transcription of the DNA template strand 5- A CATTAGTCA GTA...

    Question 5 (20 points) Make a transcription of the DNA template strand 5- A CATTAGTCA GTA GA CAT-3 a. To an mRNA? b. Read and translate the codons on m-RNA into the appropriate amino acids. c. If a mutation of the 9h base from the 3' end is mutated from an A-adenosine to T-thymine, how does this change the amino acid sequence? Be specific by redoing the problem with this one mutation. In a frame shift mutation, one base is...

  • 5. If a mutation happens in the DNA that changes the T at base 14 to a G:

    Genetic Code: The dictionary of the language of life Use the Genetic Code as a "dictionary" to solve the exercises on next page 5. If a mutation happens in the DNA that changes the T at base 14 to a G: a) What would be mutated sequence of nucleotides in the corresponding codon in the mRNA and the anticodon in the tRNA? Is there any change in the corresponding amino acid in the protein?  b) What is the name of this type of...

  • In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...

    In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)

  • please answer all parts 25) A few points: Explain how a single nucleotide substitution in the...

    please answer all parts 25) A few points: Explain how a single nucleotide substitution in the sequence of a gene can: A) cause a mutation (a single amino acid replacement) in the protein coded by the gene and B) how such a single nucleotide substitution does not necessarily lead to a mutation in the protein (a silent mutation). Be very specific and use real examples for the nucletotides and the resulting amino acid in the protein. You must provide the...

  • Please answer all.... Thank you! 81)If a polypeptide chain contains 600 amino acids, then the gene...

    Please answer all.... Thank you! 81)If a polypeptide chain contains 600 amino acids, then the gene coding for this polypeptide must contain _____. 600 nucleotides 1200 nucleotides 1800 nucleotides 1800 codons 1800 anticodons More than one of the above are correct. 82) When we altered gene triplet in the DNA produces a chain-terminating codon in the mRNA, the (1pts) result is called a reverse mutation nonsense mutation missense mutation spontaneous mutation frameshift mutation 83) A single base substitution changes the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT