Homework Answers
Add Answer to:
Can anyone explain these answers step by step. Especially I do
not know how to start...
14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram...
14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram represents some of the puzzle piece pieces used in this section. a Assembled in this form, do they represent an amino acid, c. a portion of messenger RNA, or a deoxyribonucleotide (b) Explain your answer. Opo 3. Why is DNA often called a double helix? 4. State the following ratios. (a) Guanine to cytosine in a double-stranded DNA molecule: (b) Adenine to thymine: -...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
What are the three functional groups that comprise a nucleotide? What do nucleotides have in common...
What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...
8. Glycolysis is a(n). A) five-step B) aerobic process C) catabolic D) anaerobic 9. The overall...
8. Glycolysis is a(n). A) five-step B) aerobic process C) catabolic D) anaerobic 9. The overall process of glycolysis A) produces CO B) is an anabolic pathway C) uses up 4 ATP molecules. D) produces 2 ATP molecules. 10. In step 9 of glycolysis, 2-phosphoglycerate is converted to phosphoenolpyruvate by a(n) reaction ) hydrolysis D) oxidation A) elimination B) addition 11. The nucleotides in the backbone of DNA are held together by A) phosphodiester B) hydrogen bonds D) peptide C)...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Background Information How can we predict where a coding gene will be in bacteria? And can...
Background Information How can we predict where a coding gene will be in bacteria? And can we then predict what protein will be produced? Take the DNA sequence below, for example. tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct If you were a bacterial RNA polymerase, what sequence(s) should there be in this DNA for you to bind and begin transcribing? And if you found such sequence(s), where would you begin transcription? As a human being looking at this fragment of DNA, what type of consensus sequence(s)...
1 e and 2 e 1 need help on those. ive posted this multiple times and...
1 e
and 2 e 1 need help on those. ive posted this multiple times and
peolle have anawered . but both times i posted they have given me
two diff reaponses for the answers. please help for 1e and 2e. if u
coild look at the chart and decide the sequences for me
please be simple and clear
3rd base in codon puco sucopucobuco 2nd base in codon CAIG SS2288 222222233&a The Genetic Code 1st base in codon Norma...
moose the correct alphabet (letter, noting that each and may have only ch answer can be...
moose the correct alphabet (letter, noting that each and may have only ch answer can be used more than once Answers a Eukaryotic mRNAS b.Prokaryotic mRNAs e . Transfer RNAS d. RNAs f. All RNAS e. Pre-mRNA the have a cloverleaf structure are synthesized by RNA polymerases the RNA that has the anti-codon are the template of genetic information during protein synthesis contains exons and introns is a structural component of the ribosome is the RNA that goes into the...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram represents some of the puzzle piece pieces used in this section. a Assembled in this form, do they represent an amino acid, c. a portion of messenger RNA, or a deoxyribonucleotide (b) Explain your answer. Opo 3. Why is DNA often called a double helix? 4. State the following ratios. (a) Guanine to cytosine in a double-stranded DNA molecule: (b) Adenine to thymine: -...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
8. Glycolysis is a(n). A) five-step B) aerobic process C) catabolic D) anaerobic 9. The overall process of glycolysis A) produces CO B) is an anabolic pathway C) uses up 4 ATP molecules. D) produces 2 ATP molecules. 10. In step 9 of glycolysis, 2-phosphoglycerate is converted to phosphoenolpyruvate by a(n) reaction ) hydrolysis D) oxidation A) elimination B) addition 11. The nucleotides in the backbone of DNA are held together by A) phosphodiester B) hydrogen bonds D) peptide C)...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
1 e
and 2 e 1 need help on those. ive posted this multiple times and
peolle have anawered . but both times i posted they have given me
two diff reaponses for the answers. please help for 1e and 2e. if u
coild look at the chart and decide the sequences for me
please be simple and clear
3rd base in codon puco sucopucobuco 2nd base in codon CAIG SS2288 222222233&a The Genetic Code 1st base in codon Norma...
moose the correct alphabet (letter, noting that each and may have only ch answer can be used more than once Answers a Eukaryotic mRNAS b.Prokaryotic mRNAs e . Transfer RNAS d. RNAs f. All RNAS e. Pre-mRNA the have a cloverleaf structure are synthesized by RNA polymerases the RNA that has the anti-codon are the template of genetic information during protein synthesis contains exons and introns is a structural component of the ribosome is the RNA that goes into the...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
Most questions answered within 3 hours.
-
Two waves are traveling on a string, one with a wave function,
y1 = 0.05sin(4x -...
asked 2 minutes ago -
Develop an ideal customer profile for three Dell Customer
groups( a supplier, a global business, and...
asked 4 minutes ago -
Suppose, for any future year, the probability its October rain
is more than 3 inches is...
asked 9 minutes ago -
Solve the following systems of linear equations using
substitution 12p + 3q = 15 6q +...
asked 16 minutes ago -
Prof. D went grocery shopping and purchased one dozen eggs and
one pound of flour (all...
asked 23 minutes ago -
If
somehow loop of Henle were removed - that is if the proximal tubule
was connected...
asked 23 minutes ago -
Add 1ml of 0.18M of HCl (aq) to 1ml of 0.2M of [Ag(NH3)2]Br
(aq).
Write the...
asked 30 minutes ago -
1. Smoke detectors use Am-241, an alpha emitter, to detect smoke
particles. A parent is concerned...
asked 35 minutes ago -
Scenario: Web application developed to capture customers
demographic and financial information for filling their taxes. This...
asked 38 minutes ago -
Which of the following statements are true?
1. Glass is mostly silicon dioxide and so when...
asked 1 hour ago -
Korman Company has the following securities in its portfolio of
equity securities on December 31, 2018:...
asked 1 hour ago -
Using the 12th edition of Language Awareness,
complete the following assignment:
After reading Akiba Solomon's "Thugs....
asked 1 hour ago