TRUE OR FALSE:
1. Base-pairing rules apply from one DNA strand to its partner, but not along the sugar-phosphate "handrails" of a DNA strand.
2. DNA polymerase cannot copy point mutations, so they are not passed on from parent cells to daughter cells in cell division.
3. It is not possible for a human gene to work in any other organism.
4. Mutations in regulatory DNA sequences may be more important to evolution than mutations in genes.
5. The enzyme EcoRI cuts between the G and the A in the sequence GAATTC. The enzyme BamHI cuts between adjacent G nucleotides in the sequence GGATCC. The sticky ends that are generated by the two enzymes are complementary and will stick together.
1. True. The sugar phosphate groups bind to the next sugar phosphate group of the nucleotide. Base pairing rule doesn't apply to it. These sugar phosphate groups can bind to corresponding group of either purine or pyramidine.
2. False. DNA polymerase copies what ever is present. They can't differentiate between point mutation and native sequence.
3.false. human genes are successfully introduced into organisms like yeasts. Insulin gene is introduced into yeasts and insulin is prepared by this method.
4. False. Mutations in the genes contribute to evolution more than the mutation in the regulatory regions.
5. G AATTC ECor1 cut
G GATCC BamH1 cut. These strands are not complementary and they can't stick together. So it is False.
TRUE OR FALSE: 1. Base-pairing rules apply from one DNA strand to its partner, but not...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
Question 8 1 pts Base pairing is an essential property of a DNA helix. Its presence or absence is very important for all of the following EXCEPT: Establishing the 5' to 3' polarity of a piece of DNA Providing a primer for DNA polymerase. Identifying an origin of replication. Identification of a damaged nucleotide that needs to be repaired. The use of a template to make a new daughter strand Question 9 Primase is an essential component of the replication...
Identify two restriction endonucleases that could be used to make sticky ends near the 5’ end of this DNA sequence (upper strand) so that it could be incorporated into a new plasmid. You have a short list of them in Table 9-2, and the specific, short sequences of bases that other enzymes cut at are easily obtained from web resources. You must cut as near to the 5' end as possible. Indicate the specific sequences of bases for each endonuclease...
Question 33 2 pts Which of the following statements about the process of DNA replication is true? It involves the enzyme DNA ligase, which corrects point mutations. It utilizes DNA polymerase, which catalyzes the reaction that adds a new nucleotide to the growing strand. The sequence on the new strand is always identical to one of the old parent strands. Adenine pairs with guanine, and cytosine pairs with thymine. Question 34 2 pts The DNA base...
base pairing Done stand is positively charged and th one strand contains only purind e DNA elych o ly me h 40) En me that wind the DNA strands during replication A. helicase B. mucienne E primase D. DNA polymerase 41) The leading and the lasing and differ in that A) the leading strand is synthesized in the same direction is the movement of the replication fork, and the lagring strand is synthesized in the opposite direction B) the leading...
8. In which one of the following cellular processes is DNA involved? (Select all that apply.) DNA replication transcription translation transcription and translation 10. Dogs have lots of fur that they need to keep warm during winter months. However, this makes them prone to overheating during summer months. Luckily, dogs are commonly observed "panting," which is a method used by dogs to exchange hot air for cool air thereby decreasing their temperature. What qualification life would BEST explain this? reproduction...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
help me answer these- One strand of a section of DNA Isolated from the bacterium E. cow reads: answer all parts 5- GTAAGCTACGGATAGG -3 A. Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template meaning this is the coding strand). What will be the sequence of the mRNA in this region (make sure you label the 5 and 3' ends of the mRNA)? B. How many different peptides could potentially be made from...
For the next group of questions consider a diploid cell from a eukaryotic organism with a total of ten chromosomes. After one round of the cell cycle is complete you observe a total of four daughter cells. During this cell division occurred and the resulting daughter cells are. mitosis; haploid with ten total chromosomes each mitosis; diploid with five total chromosomes each meiosis; diploid with ten total chromosomes each meiosis; haploid with five total chromosomes each Before the cell divided,...
The following statements apply to concepts and material discussed in Chapter 15; identify which statement is TRUE. Answers: A common ancestor of two species on evolutionary trees can be found at the point where the two branches meet. Humans evolved from Neanderthals about 50,000 years ago. Mitochondrial DNA is not particularly useful when trying to determine the movement pattern of humans historically across the globe. Scientists can estimate when species diverged from a common ancestor by comparing their Karyotypes. We...