Question

Write true or false ______ 1. The DNA sequence of one human being is on average...

Write true or false

______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being.

______ 2. As of 2009, all living human beings have had their entire genome sequenced.

______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C.

______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s.

______ 5. A restriction enzyme is useful because it is a generic enzyme that recognizes and cuts many different DNA sequences.

______ 6. Ligation of 2 DNA fragments is an enzyme-catalyzed reaction.

______ 7. Plasmids are circular, double-stranded DNA molecules.

______ 8. The gels used in gel electrophoresis are made of gelatin-like materials such as agarose or polyacrylamide.

______ 9. PCR stands for polyacrylamide gel electrophoresis.

______ 10. Using recombinant DNA techniques, scientists can join DNA fragments from different species.

______ 11. The process of DNA transfection is always 100% successful.

______ 12. A standard recombinant DNA procedure is to use antibiotics to kill off cells that have been successfully transfected with a recombinant plasmid.

______ 13. To determine if a DNA fragment has been successfully inserted into a plasmid, a scientist can sequence DNA of the plasmid.

______ 14. The standard procedure of gel electrophoresis separates DNA that is positively charged from DNA that is negatively charged.

______ 15. A chemical called ethidium bromide is often used to detect DNA that has been subjected to gel electrophoresis.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

des we 2. Tsue 3 Fals dr Trw ua e in Dun on &. Truu 9 false rolymsiase chain Renthion 10 Tue Dsised gees Can he fined fahe. N

Add a comment
Know the answer?
Add Answer to:
Write true or false ______ 1. The DNA sequence of one human being is on average...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The picture above represents an agarose gel that was used to analyze plasmid DNA after it...

    The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...

  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • A. Your lab To see if you understand what you did in our lab, answer the...

    A. Your lab To see if you understand what you did in our lab, answer the following based in the procedures for the restriction digest and the gel electrophoresis. 1. Using the PGLO map on p7 of the gel electrophoresis procedure, predict the size of the fragments generated by each enzyme EcoRI Hindill, and Pst! (the sizes you would expect to see on the gel.) (6 pts) Hindill -8 fragments were produced by the restriction enzyme. 2. Answer the calculation...

  • A plasmid used as a cloning vector in E. coli must have… Does sequence similarity between...

    A plasmid used as a cloning vector in E. coli must have… Does sequence similarity between genes play an important role in assigning gene function? Successful insertion of a DNA fragment into the multi-cloning region (restriction sites) of a recombinant plasmid is detected by what changes? Understand the concept of (restriction enzyme produced) DNA fragment separation by gel electrophoresis. In addition to restriction enzymes, which enzyme(s) are required to insert a fragment of DNA into a cloning vector? What is...

  • Protein P is synthesized in relatively high amounts in the human pancreas. This protein has been...

    Protein P is synthesized in relatively high amounts in the human pancreas. This protein has been isolated and purified, but its amino acid sequence has not been determined. We wish to clone the gene for protein P. (a) How can a probe be prepared to identify the gene for protein P? (b) If we have prepared a radioactive messenger RNA as our probe in part (a), how could we verify that it is the mRNA for protein P? (c) If...

  • Q1) Which of these best describes the multiple cloning site (MCS)? (1 mark) Select one: a....

    Q1) Which of these best describes the multiple cloning site (MCS)? (1 mark) Select one: a. A sequence of DNA which can be used in agarose gel electrophoresis to determine the size of DNA molecules. b. A sequence of DNA which contains recognition sites for many restriction endonucleases. c. A sequence of DNA used to identify and/or select for transformed cells. d. A sequence of DNA which initiates replication and from which DNA replication proceeds. e. A sequence of DNA...

  • Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...

    Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel electrophoresis, the DNA fragments can be separated on a gel, based on their lengths. In order to see the fragments, a stain is typically added to the gel. The size of each fragment can be determined by comparing each one to a DNA molecular weight marker of known size. Below is a map of pBR22 plasmid. The position and base pair number of the...

  • 18 15 16 17 7- What is the concentration of DNA whereby a 1:100 dilution has...

    18 15 16 17 7- What is the concentration of DNA whereby a 1:100 dilution has an observance reading of 0.015 at 260 nm? a. 6 ug mL b. 60 ug/mL c. 75 ug/mL d. 750 ug/mL 8- When measuring the concentration of RNA by spectrophotometry at 260 nm, the absorbance reading is multiplied by the dilution and a conversion factor of a. 20 6.30 c. 40 d. 50 9-DNA is isolated from a clinical sample. The absorbance at 260...

  • I need the answers for questions 2 and 3. My DNA ladder is in lane 2...

    I need the answers for questions 2 and 3. My DNA ladder is in lane 2 marked by the yellow arrow. Thanks! Here is the only other info I have. Thanks! Part 2: Gel purification and on Gel Slice and PCR Product Preparin modified from TBSci.com instructions for gaan A. Dissolving the Gel Stie Following electrophores, eral DNA band from grand place glice microcentrifuge tube Ib. Use an analytical balance to weigh pelice Rec die 2. Add 500 balance to...

  • colony which one express gene Only correct explanation not just answears pls. how to determine correct...

    colony which one express gene Only correct explanation not just answears pls. how to determine correct orientation by electrophoresis CORI -Hindi mal kpn ! Aggi -Hind III Gene CDNA EcoRI 5. G' AAT TC 3 CTTAAG. 5 Бра 5GGT ACC 3 3 CCATGG 5 pMAE2 Avr 11 M5 CCTAGGS 3 GGATCC.5 Arell ACCGGT 3 3.. TGGCCA...5 Amp Hind 1 5: AAGCTT 3 S 3. TTCGAA53 Xma C CGGG.3 GGGCGC 5 You try the following strategies in order to see if...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT