Introduction to ZBP1 protein:
ZBP1 or Zipcode binding protein 1 is an oncofetal RNA-binding protein, essential for development of nervous system. It mediates the transport and local translation of b-actin by the KH3-KH4 double domain. Reduced ZBP1 expression results in impaired neural development and a smaller cerebral cortex in the embryo.
ZBP binds to mRNA by a KH3-KH4 di-domain complex, where KH4 recognizes a non-canonical GGA sequence via an enlarged and dynamic hydrophobic groove. mRNA looping drives the ZBP1-mRNA binding and the ZBP1 concentration regulates the binding.
Determination of binding sequence.
ZBP1 contains 6 mRNA binding domains. To determine whether there is a specific sequence in the mRNA that is required for ZBP1 binding, we can use RNA oligos with KH3-KH4 recognition motifs present in it. The KH3-KH4 has to mRNA binding groove on opposite side and are separated by a spacer of about 14 nucleotide base long. The 5' to 3' order of the KH4-KH3 target sequence can be swapped to create a recognition unit, where the RNA spacer binds the sequence either in 5' to 3' or 3' to 5' direction. This binding can be studied by NMR spectroscopy to determine the specific mRNA sequence that has bind the ZBP1 protein.
5. ZBP1 binds mRNAs. How would you determine whether there is a specific sequence in the...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
Please answer only if you know how to!!! Please follow the directions and label clearly! On the next page is a small segment of DNA that includes one gene. The list below contains all th e information that must be encoded in that gene in order for both transcription and translation to occur correctly 1. On the DNA, LABEL the location of every item on the list. Hint: some locations will be approximate 2. In the space provided below the...
Question 3 (18 points). Determine whether the given sequence converges or diverges. Find the limit of each sequence (including too if appropriate) or state that the limit does not exist (DNE). Prove all of your claims and reference the theorems on sequences that you are using. Hint: The fifth word of this question is sequence, not series! (a) an = (-1)" sinn
Choose one of the health disparities listed below. Find an article (no older than 5 years) from a professional nursing journal that addresses this disparity. Then complete the assignment below. Identify the disparity. Discuss why you chose this disparity. (1 point) In your own words, provide a synopsis of the journal article. Be succinct. One good paragraph should be sufficient. Attach a copy of the journal article. (If article is not attached, zero points will be awarded. A link to...
Choose one of the health disparities listed below. Find an article (no older than 5 years) from a professional nursing journal that addresses this disparity. Then complete the assignment below. Identify the disparity. Discuss why you chose this disparity. (1 point) In your own words, provide a synopsis of the journal article. Be succinct. One good paragraph should be sufficient. Attach a copy of the journal article. (If article is not attached, zero points will be awarded. A link to...
Choose one of the health disparities listed below. Find an article (no older than 5 years) from a professional nursing journal that addresses this disparity. Then complete the assignment below Identify the disparity. Discuss why you chose this disparity. (1 point) In your own words, provide a synopsis of the journal article. Be succinct. One good paragraph should be sufficient. Attach a copy of the journal article. (If article is not attached, zero points will be awarded. A link to...
use words to describe in specific steps how you would graph the line 5X plus 2Y equals eight Question 36 5 pts Use words to describe in specific steps how you would graph the line: 5x + 2y Be sure to clearly articulate the process that you would use, highlighting key points. Make sure to describe how you would plot the line on the coordinate plane. 8. HTML Editor 7 Para first I would solve it: y--5/2x +4 then I...
Choose 5 specific marketing concepts that you believe will guide you (not your employer) as you pursue a career. Make sure that you can define those terms specifically and apply them appropriately to your own professional development.
C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...