Homework Answers
Sequence of first sequence : ACTTCTTGCCACTGGTTGCTGCAA
Sequence of second sequence: GAGTAATACAGAGCGAGAGGACGAC
Sequence of third sequence : ATTGCCAGATTGCA
Sequence of fourth sequence: CTATTCTCANNCTGCANTCNANNNCNN (N is placed where base calling is not possible due to overlapping of two equal intensity peaks)
5. As the sequences are not matching with each other, they are not identical with the template sequence.
Add Answer to:
POST-LAB #9 - DNA Barcoding: Animal Phylogeny Building by Sequencing (20pts) Directions: Using the key provided,...
Using the key provided (in the first photo on the right hand side) interpret the nucleotide...
Using the key provided (in the first photo on the right hand
side) interpret the nucleotide base sequences in the gour
electropherograms below. Write each base below its corresponding
peak.
Also, are the sequences above idential to the DNA template? Why or
why not?
POST-LAB #9 - DNA Barcoding: Animal Phylogeny Building by Sequencing (20pts) Directions: Using the key provided, interpret the nucleotide base sequences in the four electropherograms below. Write each base below its corresponding peak. - 2pts KEY...
Directions: Using the key provided, interpret the nucleotide base ssion 1) sequences in the four electropherograms...
Directions: Using the key provided, interpret the nucleotide base ssion 1) sequences in the four electropherograms below. Write each base below its corresponding peaked interpret the the 2pts mucodebase sunces in the four electroplerograms below. Write in each base below its corresponding peak KEY banana Selebobolanie brake 5. Are the sequences above identical to the DNA Template? Why or why not? -1pt 6. What are the five main components of a PCR-based dye terminator reaction? -2.5pts
Sequences from Picture: 1. A C T T C T T G C C A C...
Sequences from Picture:
1. A C T T C T T G C C A C T G G T T G C T G C A A
2. G A G T A A T A C A G A G C G A G A G G A C G A C A
3. A T T G C T C C A G A T T G C A A
4. T C T A C T...
Using the key provided (in the first photo on the right hand
side) interpret the nucleotide base sequences in the gour
electropherograms below. Write each base below its corresponding
peak.
Also, are the sequences above idential to the DNA template? Why or
why not?
POST-LAB #9 - DNA Barcoding: Animal Phylogeny Building by Sequencing (20pts) Directions: Using the key provided, interpret the nucleotide base sequences in the four electropherograms below. Write each base below its corresponding peak. - 2pts KEY...
Directions: Using the key provided, interpret the nucleotide base ssion 1) sequences in the four electropherograms below. Write each base below its corresponding peaked interpret the the 2pts mucodebase sunces in the four electroplerograms below. Write in each base below its corresponding peak KEY banana Selebobolanie brake 5. Are the sequences above identical to the DNA Template? Why or why not? -1pt 6. What are the five main components of a PCR-based dye terminator reaction? -2.5pts
Sequences from Picture:
1. A C T T C T T G C C A C T G G T T G C T G C A A
2. G A G T A A T A C A G A G C G A G A G G A C G A C A
3. A T T G C T C C A G A T T G C A A
4. T C T A C T...
Most questions answered within 3 hours.
-
Q1b. Provide an example of how pricing should interact
with the services offered by the retailer.
asked 4 minutes ago -
a mass weighing 8 pounds when attached to a spring, stretches
it 6 inches.the object is...
asked 11 minutes ago -
The following is part of the computer output from a regression
of monthly returns on Waterworks...
asked 15 minutes ago -
Bob Katz is purchasing a new Honda Pilot for $35,000. He is
financing $30,000 with a...
asked 19 minutes ago -
The equity holders of Super Nova, Inc. have 100 million of
equity in the firm. Because...
asked 18 minutes ago -
A sample of 240 observations is selected from a normal
population with a population standard deviation...
asked 34 minutes ago -
Write an (efficient) pseudocode for the implementation of each
of the following function prototypes (proper C...
asked 34 minutes ago -
Klingon Widgets, Inc., purchased new cloaking machinery three
years ago for $5.6 million. The machinery can...
asked 37 minutes ago -
Social work's goal of social betterment implies
A. That social workers should be models of good...
asked 34 minutes ago -
a
12 kg box sits on a horizontal table. a string with tension 30.4 N
pulls...
asked 36 minutes ago -
A circular coil of radius 0.120 m contains a single turn and is
located in a...
asked 48 minutes ago -
help me out
Velocity v = גf, wavelength ג = v/f and
Relative frequency = frequency...
asked 55 minutes ago