36. Option e is the answer.
Other all points are true.
37. Option d is tge right answer.
Proteins destined to be secreted move through the secretory pathway in the following order: rough ER → ER-to-Golgi transport vesicles → Golgi cisternae → secretory or transport vesicles → cell surface (exocytosis)
Please do thumbs up if you like the answer.
Thank you
Question 36 Not yet answered From the following list, select the statement that is incorrect for...
Which of the following scenarios will lead to the protein to be secreted out of the cell? Select one: a. A protein, normally localized to the Golgi apparatus, to which the Signaling peptide is deleted b. More than one of the describe scenarios will cause the protein to be secreted outside the cell c. A protein that is normally secreted, to which its Signaling peptide is deleted and replaced with a PLS d. A protein normally localized to the nucleus,...
Which of the following scenarios will lead to the protein to be secreted out of the cell? Select one: a. A protein that is normally secreted, to which its Signaling peptide is deleted and replaced with a PLS b. More than one of the describe scenarios will cause the protein to be secreted outside the cell c. A protein, normally localized to the Golgi apparatus, to which the Signaling peptide is deleted d. A protein that is normally localized to...
From the following list, select the statement that is incorrect for the corresponding organelle Select one: a. Nucleus - surrounded by a double membrane and a mesh of microfilaments underneath to protect it from damage b. Mitochondria - double membrane organelle where, in the presence of oxygen, most chemical energy is generated c. Chloroplast - Organelle thought to be the result of a endosymbiosis event where CO2 is reduced to carbohydrates d. All statements regarding their corresponding organelles are true...
Question 12 Not yet answered Points out of 1.00 P Flag question The DNA remains in the nucleus when RNA is made. That process is properly known as Select one: O a. transcription. O b. translation. c. transmutation. d. conversation. Question 13 Not yet answered Points out of 1.00 P Flag question The copy of the DNA in the form of RNA leaves the nucleus and goes to the Select one: a. cell membrane. b. Golgi bodies C. vacuole. Od....
Question 18 Please label the appropriate sequence of events in Cortisol signaling Not yet answered CRH is secreted Choose... Points out of 14.00 Cortisol is produced Choose... P Flag question Cortisol binds to its receptor Choose... - Downstream genes of cortisol signaling are being transcribed ACTH is secreted Cortisol binds to transcortin Cholesterol is brought into cells Choose... Choose Choose. Choose. Renin is produced and released from the kidney Question 19 Not yet answered Points out of 2.00 Select one:...
Question 2 Not yet answered Marked out of 1,0 Flag question Question text Proteins destined for the mitochondrial matrix must pass through the Select one: a. inner mitochondrial membrane b. intermembrane space c. outer mitochondrial membrane d. TOM complex e. All of these are correct. Question 3 Not yet answered Marked out of 1.0 Flag question Question text In nuclear transport: Select one: a. Nuclear pores allow proteins to freely move back and forth between the nucleus and cytoplasm. b....
Question 9 Not yet answered The four genes in the following cross are independent from one another. Capital letters indicate dominant alleles. If the cross produces 160 individuals, how many of them will express the dominant phenotype for all the four genes at the same time? AaBBDdEe X aaBbddEe Points out of 2.50 P Flag question Answer: Which of the following statements regarding ATP hydrolysis is FALSE? Question 10 Not yet answered Points out of 2.50 p Flag question Select...
MacBook Air Quliy What is the main function of chaperones 7 Select one: a. They help fold RNA b. They help fold proteins c. They help form vesicles d. They help degrade molecules e. They help fold DNA Question 7 Not yet answered Marked out of 10 Flag question Question text Without a signal sequence, a protein will be: Select one: a. translocated into the ER. b. localized to the cytoplasm. C. secreted, d. Imported into the nucleus. e. imported...
Question 1 Auxin transport Not yet answered Points out of 1.00 Flag question Select one: O a. Is polar, whereby auxin travels from shoot tips down the plant towards the roots. b. Produces a gradient of auxin required to establish organ formation and phototropic responses. c. Auxin is at highest concentrations, near its sources, like the apical meristems O d . Directionality of auxin movement (conferring polarity) is conferred by basally localized efflux carriers called PIN proteins e. All of...
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids о b. The template is the top strand. The peptide form will have 9 amino acids O c....