Question 45 Which of the following body axis is determined by the sperm entry point in...
If DNA was replicated via a conservative mechanism and you repeated the Meselson and Stahl experiment, what would you expect to see when the bacteria was allowed to replicate 3 times (60 min) in the N14 medium and DNA was extracted and centrifuged? Select one: a. several bands (uncountable) forming a smear across the tube b. Two bands one formed using only N14 and one formed by N15 c. it is impossible to determine given the information provided d. Two...
What would have been an appropriate conclusion if Gorbsky et al had seen the photobleached mark to move towards the centrosome? Select one: a. None of the statements could be concluded from that result b. Dyenin moves the chromosomes towards the poles of the spindle c. Microtubules shorten at the chromosome end during anaphase d. Microtubules shorten at the centrosome end during anaphase e. Kinesin moves the chromosomes towards the poles of the spindle If DNA was replicated via a...
Question 7 (1 point) Saved DNA replication occurs through the semi-conservative replication mechanism; what was observed in the Meselson and Stahl experiment, in which DNA purified from E. coli growing on 14N-medium was centrifuged in a density gradient tube, by the third generation of DNA replication? One band representing "light" DNA OTwo bands: a light density band and a faint hybrid density band Three bands: one each of light density, hybrid density, and high density bands One band representing "heavy"...
Please explain which one I missed, I got a 8/10. Might be the last question that I missed! ament Quiz -U01-202020 Fund of Biology | The Meselson-Stahl experiment demonstrated that DNA replication produces two DNA molecules each composed of _? Select one a One Old stand of nucleotides and One new strand of nucleotides b. A varying number of strands of old and new nucleotides Two strands of old and new nucleotides mixed d. Two new strands of nucleotides e....
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids о b. The template is the top strand. The peptide form will have 9 amino acids O c....
Question 1 Not yet answered Consider the following western blot for tubulin. Each lane represents a different cell line culture. What can be concluded from this blot? Points out of 2.50 P Flag question 191 97 64- 51 -B-Tubulin 39 28 19- Select one: a. Tubulins from different organisms vary in size O b. More than one statement can be concluded from this western blot c. Tubulin is expressed in all cell lines tested O d. The primary antibody used...
DNA has a strong attraction to nucleosomes because: Question 5 Not yet answered Points out of 2.50 P Flag question Select one: O a. DNA is positively charged and nucleosomal histones are negatively charged O b. DNA and nucleosomal histones are both positively charged and associate together O c. DNA and nucleosomal histones are both neutral and associate togethe о d. DNA and nucleosomal histones are both negatively charged and associate together о e. DNA is negatively charged and nucleosomal...
Question 15 Not yet answered Which of the following is TRUE about eukaryotic enhancers: An enhancer Points out of 2.50 P Flag question Select one: O a. Is a DNA sequence that can be far away from the promoter and where transcriptional activators bind O b. Is an operator DNA sequence where the Mediator complex binds o c. Is a DNA sequence where the general transcription factors bind O d. Is a protein that binds at the promoter and activates...
Question 19 Not yet answered The following diagram represents a replication bubble. The grey circles represents 4 molecules of DNA polymerase III siting on a template strand and ready to add new nucleotides to the RNA primers (not shown). Which of the 4 DNA pol III molecules will create okazaki fragments? Points out of 2.50 P Flag question A B 5' 3' Select one: o a. Cand D O b. Only A O c. B and C O d. A...
Question 1 Not yet answered Marked out of 1.00 p Flag question Which of the following is result of decisions based on inaccurate information? Select one: a. Delivering products to customers on time O b. Meeting customers' demands O c. All the answers d. Misallocation of resources Question 2 Not yet answered Marked out of 1.00 p Flag qu In digital firms, Core business processes are accomplished digitally Select one: a. True о b. FALSE Previous page f Question 7...