Which of the following could lead a mutation to express a dominant phenotype? Check all that...

Question

Question

Which of the following could lead a mutation to express a dominant phenotype? Check all that apply. The affected gene is hapl

Add a comment Improve this question Transcribed image text

Answer 1

Answer #1

1- Correct- In some cases, two copies of a gene are required for normal function, so that removing a single copy leads to expression of mutant phenotype. Such genes are referred to as haplo-insufficient.

3. Correct -mutations in one allele may lead to a structural change in the protein that interferes with the function of the wild-type protein encoded by the other allele. These are referred to as dominant negative mutations.

Add a comment

Answer 2

Similar Homework Help Questions

Which of the following could lead a mutation to express a dominant phenotype? Check all that...

Which of the following could lead a mutation to express a dominant phenotype? Check all that apply. A) Both mutant and wildtype alleles are expressed in parallel in the phenotype B) The mutant protein interferes with the function of wildtype protein C) The affected gene is haploinsufficient D) The affected gene is haplosufficient
A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heteroz...

Can someone please help me with numbers 4 and 5? A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heterozygote Dogs Assignment 2 Below are the sequences of wildtype and mutant alleles of the myostatin gene discussed in the paper introduction Wildtype Allele: AATTACTGCTCTGGAGAGTGTGAATTTGTG Mutant Allele: AATTACTGCTCTGGAGAGTGAATTTGTGTT 1) Using the genetic code table (provided on page 2) and single-letter code for amino acids, write the amino acid sequences of both predicted proteins 2) What might...
Check all of the statements that apply to neomorphic alleles of genes Check All That Apply...

Check all of the statements that apply to neomorphic alleles of genes Check All That Apply They are usually dominant to normal alleles. They are usually recessive to normal alleles. They can generate normal proteins. They can generate mutant proteins The HD-allele that makes a mutant protein with too large a polyQ region and thus causes Huntington disease is a good example. The mutation can be in either the promoter/enhancer or in the coding region The mutation can be in...

Which event may lead to cancer? Select all that apply. A. gene mutation B. functioning p53...

Which event may lead to cancer? Select all that apply. A. gene mutation B. functioning p53 protein C.Rb protein phosphorylating D. Improper replication of DNA during synthesis E. faulty DNA repair Mark for Review What's This?
70. RNA synthesis in bacteria requires which of the following? a. DNA polymerase III b. A...

70. RNA synthesis in bacteria requires which of the following? a. DNA polymerase III b. A primer c. A DNA template d. DNA Gyrase e. Deoxyribonucleotide triphosphate 86. Two phenotypically normal people have 4 children. 3 are phenotypically normal like their parents, but one is an albino. What are the probable genotypes of the parents? a. Both parents are homozygous dominant b. Both parents are homozygous recessive c. One parent is homozygous dominant and the other is homozygous recessive d....
produce random mutations in the line with boundary element 1 deleted and see that in one...

produce random mutations in the line with boundary element 1 deleted and see that in one of mutant lines, all of the cells are wild-type. Which of the following mutations could have caused this phenotype? Select all correct answers, there may be multiple. Establishment of a new boundary element in between the centromere and the spiky gene Loss of function mutation of HP1, which is a protein required for heterochromatin spreading Loss of function mutation of a histone acetyltransferase, which...

Describe what a conditional mutation is and why you would need to create one. Using the...

Describe what a conditional mutation is and why you would need to create one. Using the cdcX, cdcY, cdcZ example from your textbook, describe how complementation analysis was used to determine which cdc mutations were in the same or in different genes. Explain why this method would not work for dominant mutations. Complementation analysis determines whether recessive mutations are in the same or different genes. Mutant (type a) (cdcx) Mutant (type c) (cacy) Mutant Mutant (type a) (type c) cdccdcz...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving...

2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...
Mitosis and Meiosis Discussion Term List Use the vocab terms listed below to fill in the...

Mitosis and Meiosis Discussion Term List Use the vocab terms listed below to fill in the blanks Allele Gene Locus Chromosome Sister Chromatids Meiosis Mitosis Cell cycle Interphase Haploid S-phase Gamete Diploid Phenotype Genotype Dominant Recessive Mutant. Recombination Crossing over Wildtype Homozygous Heterozygous Homologous chromosomes if it is unable to function properly compared A. A protein is considered to be a to the version of the protein. B. Alleles can be or Meaning that in some cases one allele can...

QUESTION 7 What are the potential consequences of un-repaired DNA damage (i.e. mutations) (select all that...

QUESTION 7 What are the potential consequences of un-repaired DNA damage (i.e. mutations) (select all that apply)? A. Somatic mutations lead to changes in fitness for the affected individual ONLY B. Germ line mutations lead to cancer or other disease in the affected individual ONLY OC. Somatic mutations lead to cancer or other disease in the affected individual ONLY D. Germ line mutations lead to generation of new alleles that are passed on to the progeny E. Germ line mutations...

Which of the following could lead a mutation to express a dominant phenotype? Check all that...

Homework Answers