Which of the following could lead a mutation to express a dominant phenotype? Check all that apply.
A) Both mutant and wildtype alleles are expressed in parallel in the phenotype
B) The mutant protein interferes with the function of wildtype protein
C) The affected gene is haploinsufficient
D) The affected gene is haplosufficient
Ans :- B and D
If the mutant protein interfere with the function of wild type allele then the wild type phenotype can no longer be present in the population. This leads to mutant phenotype being dominant.
Haploinsufficient means if mutation takes place in one of the alleles then the other normal allele is not able to produce a functional protein thus the normal (wild type) phenotype does not appear. In this condition the mutated allele will be dominant.
Which of the following could lead a mutation to express a dominant phenotype? Check all that...
Which of the following could lead a mutation to express a dominant phenotype? Check all that apply. The affected gene is haploinsufficient Both mutant and wildtype alleles are expressed in parallel in the phenotype The mutant protein interferes with the function of wildtype protein The affected gene is haplosufficient
Help with both please!
10. In a wild-type diploid fungus, protein E (encoded by the haplosufficient gene “E”') normally homodimerizes, and the E-E dimer catalyzes a biochemical reaction necessary for the production of a dark pigment. E represents a mutant, dominant negative allele of gene E. What is the predicted phenotype of a fungus cell of genotype ET/E”, and why? A) mutant (no pigment production), as E is haplosufficient B) mutant (no pigment production), as no E-E dimers will form...
Can someone please help me with numbers 4 and 5?
A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heterozygote Dogs Assignment 2 Below are the sequences of wildtype and mutant alleles of the myostatin gene discussed in the paper introduction Wildtype Allele: AATTACTGCTCTGGAGAGTGTGAATTTGTG Mutant Allele: AATTACTGCTCTGGAGAGTGAATTTGTGTT 1) Using the genetic code table (provided on page 2) and single-letter code for amino acids, write the amino acid sequences of both predicted proteins 2) What might...
Check all of the statements that apply to neomorphic alleles of genes Check All That Apply They are usually dominant to normal alleles. They are usually recessive to normal alleles. They can generate normal proteins. They can generate mutant proteins The HD-allele that makes a mutant protein with too large a polyQ region and thus causes Huntington disease is a good example. The mutation can be in either the promoter/enhancer or in the coding region The mutation can be in...
Predict the phenotype of a lac Y mutant, which is a mutation in the gene for lactose permease. a. The lac genes would be expressed efficiently only in the absence of lactose. b. The lac genes would be expressed efficiently until the lactose supply already in the cell is exhausted. c. The lac genes would be expressed continuously. d. Expression of the lac genes would cease immediately.
Which event may lead to cancer? Select all that apply. A. gene mutation B. functioning p53 protein C.Rb protein phosphorylating D. Improper replication of DNA during synthesis E. faulty DNA repair Mark for Review What's This?
70. RNA synthesis in bacteria requires which of the following? a. DNA polymerase III b. A primer c. A DNA template d. DNA Gyrase e. Deoxyribonucleotide triphosphate 86. Two phenotypically normal people have 4 children. 3 are phenotypically normal like their parents, but one is an albino. What are the probable genotypes of the parents? a. Both parents are homozygous dominant b. Both parents are homozygous recessive c. One parent is homozygous dominant and the other is homozygous recessive d....
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...
QUESTION 7 What are the potential consequences of un-repaired DNA damage (i.e. mutations) (select all that apply)? A. Somatic mutations lead to changes in fitness for the affected individual ONLY B. Germ line mutations lead to cancer or other disease in the affected individual ONLY OC. Somatic mutations lead to cancer or other disease in the affected individual ONLY D. Germ line mutations lead to generation of new alleles that are passed on to the progeny E. Germ line mutations...
Mitosis and Meiosis Discussion Term List Use the vocab terms listed below to fill in the blanks Allele Gene Locus Chromosome Sister Chromatids Meiosis Mitosis Cell cycle Interphase Haploid S-phase Gamete Diploid Phenotype Genotype Dominant Recessive Mutant. Recombination Crossing over Wildtype Homozygous Heterozygous Homologous chromosomes if it is unable to function properly compared A. A protein is considered to be a to the version of the protein. B. Alleles can be or Meaning that in some cases one allele can...