1.Before the advancement in DNA technology, most crime labs relied upon the ABO blood grouping system to characterize bloodstains. This indicates that the blood could have come from 4 to 49% of the population.Most crime labs are relying on DNA analysis to charcterise bloodstains, so blood source can now be statistically narrowed down to one person out of several million or even several billion.
2. 3" GGGACCCGAGACATTTCTTATCACACAACTAAG 5"
3. Blood is an excellent source of human DNA.DNA is obtained from the white blood cells of the human blood but not from the red blood cells which lacks nuclei, (as nuclei is the repository of the genetic material i.eDNA)
4. It is possible to find out the gender of a person from the blood sample. Humans generally contains 22autosomes and 1 pair of sex chromosomes, females have a pair of X-chromosomes while males have an X-chromosome and a Y-chromosome. Therefore, the presence or the absence of Y-chromosome can determine the gender of a person from a unknown sample
The Ught Went Out on Sunshine In the quiet town of Utopla, 90 year-old Sunshine Moon...
Question 4: The blood left at the crime scene at Sunshine’s house was from a male. Which of the following DNA profiles (A or B) could have come from the suspect? Explain in detail why you chose the sample you did. 100 Nucleotides long 120 140 160 1 180 200 A M Amelogenin B
please answer as much of the questions as you can and not only one question: 1. What is the pseudoautosomal region? The region on the Y chromosome where the male-determining gene is found The region on the X chromosome where the female-determining gene is found A region on the Y chromosome where the gene, when mutated, causes androgen insensitivity syndrome A region at which the X and Y chromosomes both have copies of the same genes A region at which...
Skill Check DNA All in Our Genes SU2020) Protected ViewSaved to this PC- Design Draw Layout References Malings Review Help les from the Internet can contain vs. Unless you need to edit it's safe to stay in Protected View farah dowod . Activity 3: Analysis of Forensic Samples Crate Editing This photo is an actual photo of a gel that was run using the samples outlined in this lab From left to right Lane 1: A Hindi DNA digest used...
A 62-year-old female is admitted to the general medical unit upon recommendation from her oncologist because of "low blood counts." She has had multiple recent hospital admissions for this same condition resulting from Myelodysplastic Syndrome in which the bone marrow does not produce enough healthy cells. She also has had recent valve surgery for aortic stenosis. During this admission, she received Neupogen, a protein to stimulate her bone marrow and white blood counts, with no success. The patient has expressed...
A 62-year-old female is admitted to the general medical unit upon recommendation from her oncologist because of "low blood counts." She has had multiple recent hospital admissions for this same condition resulting from Myelodysplastic Syndrome in which the bone marrow does not produce enough healthy cells. She also has had recent valve surgery for aortic stenosis. During this admission, she received Neupogen, a protein to stimulate her bone marrow and white blood counts, with no success. The patient has expressed...
A 62-year-old female is admitted to the general medical unit upon recommendation from her oncologist because of "low blood counts." She has had multiple recent hospital admissions for this same condition resulting from Myelodysplastic Syndrome in which the bone marrow does not produce enough healthy cells. She also has had recent valve surgery for aortic stenosis. During this admission, she received Neupogen, a protein to stimulate her bone marrow and white blood counts, with no success. The patient has expressed...
T/F: Human blood type has 6 genotypes. T/F: If albinism is a recessive trait and 2 carrier parents mate, they have a 25% chance of having 1. 2. an albino child. 3. 4. 5. 6. 7. 8. 9. 10. T/F: The sex of an individual does not affect patterns of inheritance for most traits. T/F: Genes are segments of RNA that code for proteins T/F: Wavy hair is an example of incomplete dominance. T/F: If a man has normal color...
A 68 year old woman had a swollen painful knee. The pain woke her up out of a sound sleep. She has not had any major health problem except essential hypertension. She takes Avalide 10 mg daily. She travels to Martha’s Vineyard every year and walks the beach without shortness of breath or joint pain. She did not recall being bitten by a tick. She has no evidence of any of neuralgia such as Shingles, Bell’s Palsy or CNS infections....
number 5 please Case Presentation Jordan is a healthy twenty-six year old male. He is an only child, son of Jessica age 45 and Ryan 43. Jordan is married and has no children. Eight years ago, Jordan's mother was diagnosed with Huntington's disease, a hereditary disease that destroys neurons in the basal ganglia of the brain. This destruction of brain cells causes progressive deterioration of both mental and physical abilities. The symptoms of the disease generally do not develop until...
RC 200 Cardiopulmonary Pathology SOAP Assignment #4 Case Study: Tuberculosis Name:___________________________________ Date:___________________________________________ ADMITTING HISTORY A 58-year-old Caucasian man was well known and liked by the staff at the Samaritan Shelter for the Homeless. The social workers at the shelter had spent a great deal of time and resources working with the man on a number of areas, including his alcohol addiction. Their records showed that they had not seen him for about 6 months. When they last had seen him,...