Question

3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in the top (5' to 3) strand. 5'-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG- 3' 3-CGTGCCGCCTCGCCAAGAACCGTCGCCGGCGTGCTAGAGCAACGGCGGCC- 5' Once Cas9 binds to a PAM sequence, it unwinds the DNA. If the guide RNA matches the DNA sequence next to the PAM, the guide RNA will bind to the complementary DNA strand. If not, the DNA will zip back together and Cas9 will keep binding to other PAM sequences until it finds the matching target DNA 4. Below is a partial sequence of a guide RNA. The underlined section of the RNA is designed to match a specific target DNA sequence. 5'-GGCGGAGCGGUUCUUGGCAGGUUUUAGAGCUAGAAAUAGC-3' Review the partial gene sequence reshown below. It contains a target DNA sequence that matches the guide RNA above. Highlight the one PAM sequence in the top (5' to 3') strand that is next to this target DNA sequence. (The sequence upstream, toward the 5 end, of this PAM should match the underlined sequence in the guide RNA, which makes the opposite DNA strand complementary to the underlined sequence. Remember that U's in RNA are equivalent to T's in DNA.) 5'-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG-3' 3'-CGTGCCGCCTCGCCAAGAACCGTCGCCGGCGTGCTAGAGCAACGGCGGCC-5' Step 2: Binding Once Cas9 binds to the correct PAM, the guide RNA binds to the complement of the target DNA sequence. 5. Write down the guide RNA sequence that binds to the DNA, and the DNA sequence that it binds to the complement of the target DNA). Ithel the 5' and 3' ends for both the RNA and DNA strands. Step 3: Cleaving Once the guide RNA binds to the complement of the target DNA sequence, it activates the nuclease activity (DNA- cutting ability) of the Cas9 enzyme. Cutting DNA is also called "cleaving." Cas9 always cleaves both strands of DNA. It cleaves both the target DNA and its complement three nucleotides upstream (toward the 5' end) of the PAM sequence. 6. Rewrite the target DNA sequence and its complement below, indicating where Cas9 would cut both strands of DNA with a large space or vertical line (I).

Answer 1

Ans 3- PAM are protospacer adjacent motif that is require for Cas9 to function. It varies depending on the bacterial species of the Cas9 gene. Streptococcus pyogenes derived Cas9 nuclease is most commonly used nuclease that recognizes a PAM sequence of NGG.

PAM sequences in given DNA sequences are as follows:-

5'GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG-3'