The DNA sequence below is copied from question 30 and has a mutation (highlighted in yellow).
TACGTACATACT
1) Transcribe the new sequence.
2) Translate the new sequence.
What is the mutation?
Original sequence:
TACGTCCATACT
Mutated sequence:
TACGTACATACT
1.The mutated DNA sequence is TACGTACATACT.
Transcription is the process in which a DNA sequence is copied into RNA by the enzyme RNA polymerase.RNA polymerase binds to the DNA sequence ,and separates the two strands of DNA helix.Then RNA polymerase builds a RNA strand that has nucleotides complementary to the nucleotides in the DNA sequence.Three steps of transcription are Initiation,Elongation and Termination.For Adenine the complementary nucleotide is Thymine and vice versa but in RNA sequence uracil is instead of thymine.For Guanine,the complementary nucleotide is cytosine and vice versa.
The transcribed new sequence is :
AUGCAUGUAUGA
2. Translation is the process in which the nucleotides in RNA sequence is decoded into sequence of amino acids in a polypeptide chain.There are four nucleotides and 20 different amino acids are formed from this.Three nucleotides together called codon is codes for one amino acid.Translation starts with start codon AUG.It takes place inside ribosome.tRNA act as adapter molecule between the mRNA and amino acids.tRNA contain a three base anticodon that bind with corresponding mRNA and brings the correct amino acid.The amino acids are linked by peptide bonds to form protein
The translation of above sequence is:
Methionine(start)-Histidine - valine - Stop
While analyzing the original sequence and mutated sequence,this is a point mutation in which a single nucleotide is substituted with another nucleotide.The nucleotide cytosine in the original sequence is substituted with Adenine in the mutated sequence.More specifically this is Missense Mutation.In this mutation ,a single change in the nucleotide can result in change in the amino acid decoded.
The DNA sequence below is copied from question 30 and has a mutation (highlighted in yellow)....
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
Phenylalanin (Phe) Glycine (Gly) (Glu) Glutamic acid O Leucine (Leu) Serine (Ser) (Asp) Aspartic acid Alanine (Ala) coroca GU Tyrosine (Tyr) А с Valine (Val) G A G Cysteine (Cys) C U GTyptophan (Trp) START HERE Arginine (Arg) A G U A С Leucine (Leu) Serine (Ser) A с с poleo U G G A Proline (Pro) Lysine (Lys) Asparagine (Asri Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon...
There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5' was mutated so that now it reads 3' ATC 5. What kind of mutation is this? SECOND POSITION с A U phenyl- slanine tyrosine cysteine U U с А serine leucine stop stop stop tryptophan G histidine U С A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION isoleucine asparagine G U с А G serine А threonine methionine lysine arginine valine aspartic...
You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
You are given the below piece of Template DNA (the same as the previous question). How many amino acids are in the protein encoded by this gene? 3'AATACGGGGAGCITTACAGAATTCAAATCA5' SECOND POSITION с A G U phenyl- alanine tyrosine cysteine U serine stop leucine stop tryptophan stop U с A G U с A histidine с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с A А threonine methionine lysine arginine valine aspartic acid glutamic U с...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...