Question

Various mechanisms for regulation of the trp operon are described. Which is correct? Select one: a....

Various mechanisms for regulation of the trp operon are described. Which is correct?

Select one:

a. Its transcription is down-regulated, when the Trp level is high.

b. Ribosome stalled due to a low Trp level induces an mRNA structure suitable for its continued transcription.

c. Both a and b

d. Neither a nor b

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The right option is option (c) Both A and B

Explanation:-

The TRP operon is an example of the repressible operon type. This is different than inducible operon in which presence of a substrate initiate the transcription of the operon. In this operon system, if a molecule is present then the tanscription is down regulated.

This is because the end product of the pathway for which the gene products of the operon perform is the same molecule which turns it off.

In case of operon of trp, the enzymes are involved in biosynthesis of tryptophan but when there is tryptophan already, there is no need to make more tryptophan as it is useless. So it is downregulated when tryptophan levels are high in cell.

In the ribosome stallation process, there is sequence which codes for multiple tryptophan and if the polymerase make the mRNA of that sequence and there is tryptophan present that tryptophan will be charged onto tRNA and brought for translation as in prokaryotes both transcription and translation is happening at the same time. Now right after it, there is stem loop structure which forms and terminate the reaction before the whole opeon is transcribed. So in presence of tryptophan that happens.

Now when there is less tryptopha the ribosome will stall at that stretch of mRNA where there are multiple tryptophan codons as charged tRNA will not come and this stallation prevent the termination of the transcription.

So both the option A and B are correct.

Add a comment
Know the answer?
Add Answer to:
Various mechanisms for regulation of the trp operon are described. Which is correct? Select one: a....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Mechanism for regulation of the trp operon is described. Which is incorrect? A. Transcription is down-regulated...

    Mechanism for regulation of the trp operon is described. Which is incorrect? A. Transcription is down-regulated by the trp repressor, which is activated upon binding of Trp. B. Ribosome stalled due to a low concentration of Trp induces an alternative mRNA structure, resulting in continued transcription. C. Activity of the Trp synthesis operon is doubly controlled by the Trp concentrations. D. All of these. E. None of these.

  • 42. Which is correct about the peptide elongation by ribosome? Select one: a. Addition of a...

    42. Which is correct about the peptide elongation by ribosome? Select one: a. Addition of a new amino acid is achieved by peptide transfer from the A site tRNA to the P site URNA. b. Translation is not affected by the cellular availability of GTP. O c. Peptide bond formation is catalyzed by enzymatic proteins in ribosome. O d. The peptide bond is formed by a nucleophilic attack of the A-site NH2- onto the P-site -COOH. O e. None of...

  • Page < 2 > of 2 D. The trp operon would be expressed at high levels,...

    Page < 2 > of 2 D. The trp operon would be expressed at high levels, comparable to its expression in the absence of trp 6. Based upon what you have learned about the E. coli trp operon, what could you say about expression of its structural genes in cells with large amounts of environmental trp, but expressing a mutant trp repressor that is unable to bind trp? A. The trp operon would be completely repressed due to the abundance...

  • Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...

    Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...

  • expressed at high levels, comparable to its expression in the absence of trp 6. Based upon...

    expressed at high levels, comparable to its expression in the absence of trp 6. Based upon what you have learned about the E. coli trp operon, what could you say about expression of its structural genes in cells with large amounts of environmental trp, but expressing a mutant trp repressor that is unable to bind trp? A. The trp operon would be completely repressed due to the abundance of trp B. The trp operon would be transcribed much less than...

  • Which of the mechanisms involving siRNA- and miRNA-based gene regulation is INCORRECT? Select one: a. Cleavage...

    Which of the mechanisms involving siRNA- and miRNA-based gene regulation is INCORRECT? Select one: a. Cleavage of mRNA b. Inhibition of translation c. Post-translational modification d. Degradation of mRNA e. Transcriptional silencing

  • gene regulation of bacteria operon systems. Protected View . Saved to this PG References Mailings Review...

    gene regulation of bacteria operon systems. Protected View . Saved to this PG References Mailings Review View Help Tell me what you want to do ernet can contain viruses. Unless you need to edit, it's safe to stay in Protected View Enable Editing 5. What happens if lactose levels are low? Put the following list in order (1-5). RNA polymerase is blocked from transcribing the genes for the lactose metabolizing enzymes When RNA polymerase binds to the promoter, it cannot...

  • 45. Which is the factor(s) involved in the regulation of gene activity? Select one: O a....

    45. Which is the factor(s) involved in the regulation of gene activity? Select one: O a. Transcriptional repressor/activator proteins, which bind to the operator/enhancer sequence regions. O b. SAM binding to a riboswitch mRNA. O c. Alterations in mRNA conformations by SAM during the transcription. O d. All of these. O e. None of these. 13. The ring is built onto ribose-5-phosphate of PRPP for its de-novo nucleotide biosynthesis, while the ring structure of the bases are synthesized separately and...

  • Microbiology study guide questions. Please Help! s. which of the following statements about water activity is not true? a) many fungi can tolerate aw levels of 07-0.8 b) many microorganisms grow...

    Microbiology study guide questions. Please Help! s. which of the following statements about water activity is not true? a) many fungi can tolerate aw levels of 07-0.8 b) many microorganisms grow well at an aw of 0.98 e sear water has an aw of 0.98 e-xerephiles thrive in dry conditions DNA typically becomes disordered below an a of o.90 Which of the following descriptions about ribosome structure is not true? a) 80s is the size of the intact functional ribosome...

  • EXAMPLE: ANSWER 12 :- From the above mentioned data, the significance of ATP molecule in the...

    EXAMPLE: ANSWER 12 :- From the above mentioned data, the significance of ATP molecule in the event progression is seen although taking into consideration that the process is carried out in an in-vitro manner, the possibility of transcription occuring decreases taking into consideration the errors associated with the changes in certain conditions associated with the experimental setup and hence it becomes difficult to identify if there is actual phosphorylation occuring of the nucleosomal histone proteins. This in other terms cannot...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT