Mechanism for regulation of the trp operon is described. Which is incorrect?
A. Transcription is down-regulated by the trp repressor, which is activated upon binding of Trp.
B. Ribosome stalled due to a low concentration of Trp induces an alternative mRNA structure, resulting in continued transcription.
C. Activity of the Trp synthesis operon is doubly controlled by the Trp concentrations.
D. All of these.
E. None of these.
Answer - A. Transcription is down-regulated by the trp repressor, which is activated upon binding of Trp.
Explanation :
The trp operon is controlled by both a repressor protein binding to the operator region as well as by translation-induced transcriptional attenuation. The trp repressor binds the operator region of the trp operon only when bound to tryptophan. This makes tryptophan a co-repressor of the operon. The trpL gene encodes a non-functional leader peptide which contains several adjacent trp codons. The tructural genes of the operon responsible for tryptophan biosynthesis are trpE, D, C, B and A. When trptophan level are high some binds to the repressor which then binds to the operator region and inhibits transcription. The mechanism of attenuation of the trp operon is diagrammed below.
Mechanism for regulation of the trp operon is described. Which is incorrect? A. Transcription is down-regulated...
Various mechanisms for regulation of the trp operon are described. Which is correct? Select one: a. Its transcription is down-regulated, when the Trp level is high. b. Ribosome stalled due to a low Trp level induces an mRNA structure suitable for its continued transcription. c. Both a and b d. Neither a nor b
42. Which is correct about the peptide elongation by ribosome? Select one: a. Addition of a new amino acid is achieved by peptide transfer from the A site tRNA to the P site URNA. b. Translation is not affected by the cellular availability of GTP. O c. Peptide bond formation is catalyzed by enzymatic proteins in ribosome. O d. The peptide bond is formed by a nucleophilic attack of the A-site NH2- onto the P-site -COOH. O e. None of...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
Yet, all the cells in your body contain the same genes (and same alleles). The difference across cell types is that genes get selectively expressed (turned on or off) based on the proteins needed for cellular function given their environment. Select which statement explains the reason why hair does not normally grow on your muscle cells. a. Muscle cells have the gene for keratin, but do not express it b. Muscle cells do not have the gene for keratin and...
Microbiology study guide questions. Please Help! s. which of the following statements about water activity is not true? a) many fungi can tolerate aw levels of 07-0.8 b) many microorganisms grow well at an aw of 0.98 e sear water has an aw of 0.98 e-xerephiles thrive in dry conditions DNA typically becomes disordered below an a of o.90 Which of the following descriptions about ribosome structure is not true? a) 80s is the size of the intact functional ribosome...
1. According to the paper, what does lactate dehydrogenase (LDH) do and what does it allow to happen within the myofiber? (5 points) 2. According to the paper, what is the major disadvantage of relying on glycolysis during high-intensity exercise? (5 points) 3. Using Figure 1 in the paper, briefly describe the different sources of ATP production at 50% versus 90% AND explain whether you believe this depiction of ATP production applies to a Type IIX myofiber in a human....