Hello. At what step does attenuation regulate expression of the trp operon? a)transcript polyadenylation b)transcript capping...
Hello. At what step does attenuation regulate
expression of the trp operon?
a)transcript polyadenylation
b)transcript capping
c)transcript elongation
d)transcript initation
Homework Answers
Add Answer to:
Hello. At what step does attenuation regulate
expression of the trp operon?
a)transcript polyadenylation
b)transcript capping...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
What is transcript factor? How does transcript factor regulate gene expression?
What is transcript factor? How does transcript factor regulate gene expression?
What is transcript factor. How does transcript factor regulate gene expression
What is transcript factor. How does transcript factor regulate gene expression
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alterna...
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....
Page < 2 > of 2 D. The trp operon would be expressed at high levels,...
Page < 2 > of 2 D. The trp operon would be expressed at high levels, comparable to its expression in the absence of trp 6. Based upon what you have learned about the E. coli trp operon, what could you say about expression of its structural genes in cells with large amounts of environmental trp, but expressing a mutant trp repressor that is unable to bind trp? A. The trp operon would be completely repressed due to the abundance...
b. What is the polycistron in the Lac operon? In the Trp operon? d. Name an aspect of...
b. What is the polycistron in the Lac operon? In the Trp operon? d. Name an aspect of prokaryotic gene regulation that can only occur in a prokaryote and not a eukaryote e. Provided the wildtype lac operon, give three different examples of mutations, what they target, and how they disrupt WT regulation of the operon. f. Describe how the RNA leader of the Trp operon can repress/induce gene translation
10. Describe what is meant by a) RNA capping and b) Polyadenylation . 11. Describe the...
10. Describe what is meant by a) RNA capping and b) Polyadenylation . 11. Describe the process of RNA splicing. Please include what the role of the spliceosome, snRNAs and alternative splicing. 12. A prokaryotic RNA may contain many AUG codons. How does the ribosome distinguish AUG codons specifying initiation from AUG codons specifying internal methionine? 13. How does each tRNA molecule recognize the one amino acid in 20 that is its proper partner? Please explain and include in your...
expressed at high levels, comparable to its expression in the absence of trp 6. Based upon...
expressed at high levels, comparable to its expression in the absence of trp 6. Based upon what you have learned about the E. coli trp operon, what could you say about expression of its structural genes in cells with large amounts of environmental trp, but expressing a mutant trp repressor that is unable to bind trp? A. The trp operon would be completely repressed due to the abundance of trp B. The trp operon would be transcribed much less than...
For regulation of the trp operon, what happens to in the absence of tryptophan? repressor protein...
For regulation of the trp operon, what happens to in the absence of tryptophan? repressor protein (a) It binds to the operator, and represses transcription of genes in the trp operon (b) It cannot bind to the operator, and transcription of genes in the trp operon takes place (c) It binds to the regulatory gene that codes for the TrpR repressor, and represses its transcription (d) It cannot bind to the regulatory gene that codes for the TrpR repressor, and...
Catabolite repression can regulate the expression of the lac operon in E. coli. In terms of...
Catabolite repression can regulate the expression of the lac operon in E. coli. In terms of this positive regulation of the lac operon: What is the activator? Would it work in cis or trans? What molecule binds to the allosteric domain of the activator? What influences strongly the levels of the molecule you answered for part b? To what regulatory sequence does the activator bind? What part/domain of the activator? What is the effect of this binding? Name the two...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....
Page < 2 > of 2 D. The trp operon would be expressed at high levels, comparable to its expression in the absence of trp 6. Based upon what you have learned about the E. coli trp operon, what could you say about expression of its structural genes in cells with large amounts of environmental trp, but expressing a mutant trp repressor that is unable to bind trp? A. The trp operon would be completely repressed due to the abundance...
expressed at high levels, comparable to its expression in the absence of trp 6. Based upon what you have learned about the E. coli trp operon, what could you say about expression of its structural genes in cells with large amounts of environmental trp, but expressing a mutant trp repressor that is unable to bind trp? A. The trp operon would be completely repressed due to the abundance of trp B. The trp operon would be transcribed much less than...
For regulation of the trp operon, what happens to in the absence of tryptophan? repressor protein (a) It binds to the operator, and represses transcription of genes in the trp operon (b) It cannot bind to the operator, and transcription of genes in the trp operon takes place (c) It binds to the regulatory gene that codes for the TrpR repressor, and represses its transcription (d) It cannot bind to the regulatory gene that codes for the TrpR repressor, and...
Most questions answered within 3 hours.
-
Notational Inc. is considering installing a new server. The
machine costs $100,000 and is expected to...
asked 17 minutes ago -
38%
of adults say cashews are their favorite kind of nut. You
randomly select 12 adults...
asked 18 minutes ago -
Given the information coding of DNA strand:
5'-TTT-TAC-GAA-GAG-TGA-3',
Write the corresponding DNA template and mRNA strand...
asked 38 minutes ago -
2. Boris recently synthesized an explosive compound he named
Badenoughium. The molecular formula for Bdenoughium is...
asked 4 hours ago -
5. A car decelerate evenly from a velocity of 50mph until rest
in a distance of...
asked 4 hours ago -
IN HTML Programming
1. Write a script that inputs integers (one at a time) and
passes...
asked 4 hours ago -
A dentist uses a mirror to examine a tooth that is 0.75 cm in
front of...
asked 4 hours ago -
You set up a 100,000 line of credit for the business on 1/1/X8,
annual interest is...
asked 4 hours ago -
What is the measurement uncertainty of a pan balance? How did you
get that?
asked 4 hours ago -
Suppose four firms have market shares of 30%, 30%, 20% and 20%.
What is the Herfindahl-Hirschman...
asked 4 hours ago -
IBT Industrial Solutions produces forty units of rack and pinion
type steering gears during an eight...
asked 4 hours ago -
The Ksp for PbI2 is 9.8×10−9 . Will PbI2 precipitate if 2.5 mL
of 0.0025 M...
asked 4 hours ago