The third option is the correct answer, i.e. this photoautotrophic organism represents a colony of prokaryotic cells.
Oscillatoria is a cyanobacteria or blue-green algae. This alga is always in filamentous colonial form. Filaments are formed by prokaryotic cells arranged in a single row. This row of cells is covered by mucilage. The cells are considered are prokaryotes because they lack nuclei and any membrane-bound organelles. These two features are the main characteristics of any prokaryotic cell.
Explanation of the wrong options -
Cellulosic cells - Cellulose is present in the cell wall of this algae. But that doesn't mean that the cell is formed by cellulose only. The cell walls also contain pectin and mucilage. Inside the living protoplasm, there are many organic materials as well.
Eukaryotic cells - The cells of this algae don't have proper nuclei and any membrane-bound organelles. In a eukaryotic cell, the genetic material is contained in a nucleus and there are other membrane-bound organelles also. That's why this alga can't be a eukaryotic organism.
Diatomic cells - Each diatom is surrounded by a thick cell wall formed by silica, which is specifically called a frustule. This is the most important feature of a diatom. The cells of Oscillatoria don't have a frustule. That's why this alga is not a diatom.
The organism shown below shows vegetative cells of Oscillatoria. This organism is photoautotrophic and represents a...
The sequence below represents the first section of the template strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written 3 GTAACTĀTAATTACGCGTATAATGAT 5 What would be the nucleotides that form the promoter? What would be the 5'UTR sequence? What would be the sequence...
The species below shows the transition state for the The species shown below represents the transition state for the CH2CH3 HIO ---C---- Br 6 HH A) reaction of 1-propanol with HBr. B) reaction of 1-bromopropane with OH". C) addition of HBr to propene with peroxides. D elimination of HBr from 1-bromopropane.
9. The fossil evidence indicates that the earliest cells lived about: a. 1.5 million years ago b. 2.5 million years ago c. 3.5 million years ago c. 3.5 billion years ago 10. Charles Darwin first proposed the idea of a. genetic engineering b. gene swapping C. co-dominance d. natural selection 11. The basic difference between a prokaryotic cell an a eukaryotic cell is: a. the presence of a nucleus b. asexual reproduction c. there is no difference d. the presence...
Consider the three graphs below, which show the quantity of DNA in cells measured by fluorescence in flow cytometry. The x-axis represents the relative amount of DNA per cell, and the relative intensity of the florescence on the y-axis represents the number of cells with that amount of DNA in the cell. Look at the experiment shown on page 248 of your textbook. 1) A B C 2) 20-40,一60一助100 20-40 60一負100 40, 60 N 100 Amount of fluorescence per cell...
Unit 3 Study Resource Meiosis • Process by which diploid cells create haploid cells NOT part of the cell cycle > only some cells ever undergo meiosis During meiosis I, homologous chromosomes line up to allow them to be separated into two new cells o They can become "tangled" during this phase, which leads to crossing-over (rearranging the alleles) O Result of meiosis I is two non-identical haploid cells Meiosis Il looks very similar to mitosis, in that sister chromatids...
QUESTION 1 The following molecule (shown below) represents a compound that can induce platelet aggregation and vasoconstriction COOH OH True O False QUESTION 2 A glycerophospholipid with the phosphate ester group bonded to ethanolamine would be classified as a O cephalin O lecithin Osphingomyelin cerebroside ganglioside
please help with all 3 Incorrect Question 19 0/10 pts The sequence below represents the first section of the coding strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. 5' GTAACTATAATTATGCGTATAATG 3' What would be the nucleotides that form the promoter? GUAACUAU...
In the figure shown below, the top panel represents the situation where Pr > 1 and the bottom panel represents the situation where Pr <1. In the figure shown below, the top panel represents the situation where Pr>1 and the bottom panel represents the situation where Pr <1. .8+(x) -- 8(x) loo 8(x) 8t(x) True False O
Question 1 Match the term with the best definition or description; most topics relate to the regulation of gene expression. General type of protein which will increase transcription rates when it attaches to a site A. Factor connected to a particular gene - B. Co-repressor C. Enhancer D. Promoter E. Structural F. Intron G. Activator H. Operator I. Basal transcription J. Glucocorticoid receptor K. Sigma factor L. Mediator M. Inducer N. TATA box O. Repressor The rates of mRNA produced...
The graph below shows the reaction profile for the chemical reaction shown below: H_2 O_2(g) H_2(g) + O_2(g) Specifically, the graph represents the concentration of the reactants and products as a function of time. Which of the following statements about this graph are correct? Arrow A indicates the reaction at equilibrium because it shows the relative concentration of the reactants decreasing and the products increasing. Arrow B indicates the reaction at equilibrium because the relative concentrations of X and Y...