5. Write the first stems of the sequence (2pts) a, = 2; an: Zanni + 5
***Answer these questions by examining the image of a tRNA (2pts). 21. The anti-codon sequence on the tRNA (start with first position on 5' end): 22. The mRNA codon sequence that would connect with this tRNA (5' end): esc
2 3. Leta, = (-1) represent the nth term of a sequence. (a) Write the first 5 terms of the sequence. [5 points] (b) What kind of sequence is this? Explain. (4 points) (c) What is >a, called? How is it different from the sequence in part (a)? Explain [4 points] (d) Evaluate: Σ.T7 points]
2- 4. Given the Sequence below(-3)***** a) Write the first five terms of the sequence. b) Provide a sketch for the first five terms of the sequence. Does the sequence approach a number? c) Does the sequence Converge or Diverge as no? Explain your answer. d) Find lim,--..(am + b), where a, the general term you found in a) and m2+1 Does the limit converge?
The nth term of a sequence is given. Write the first four terms of the sequence. a = 217 O-5, -3, -1, 1 O -5, -3, 1,9 O-7,-5, -3, -1 O-7,-5, -3,1 O None of these
4 (2pts) Your sequence of DNA is S CGTTACACOTGGACTGAGGATGTAGCCAT 3". What is the sequence of the longest peptide that can be produced from this doublestranded template? The labeled base is mutated from a G to T. What is the result of this change?
Q3 Determine the counting sequence of the following counters (4pts) 1- (2pts) 120 Ho > KO Ja los 2 PC K2 K1 CLK 2- (2pts) 00 13 1. Jood PC CLK
1. Write out the first five terms of each sequence and determine if the sequence is convergent or divergent JUSTIFY YOUR ANSWERS We were unable to transcribe this image
1. Write out the first five terms of each sequence and determine if the sequence is convergent or divergent JUSTIFY YOUR ANSWERS
1. The terms of a sequence are given by an = n²-3. Find ay-az. (2pts)
sequence {d}} = {(–1)n-1 (2-2)} 23. Write down the first five terms of the
Write out the first four terms of the following recursive sequence. a0=3,a1=2, and an+2=an+1⋅an