21. Anticodon sequence on tRNA is 5'- CAG -3'
22.The mRNA codon sequence that would connect with this tRNA will be 5'- CUG- 3' on mRNA.
The tRNA is read from 3' to 5' end on the mRNA from 5'to 3' end during protien synthesis. In this case the sequence GAC pairs with CUG.
***Answer these questions by examining the image of a tRNA (2pts). 21. The anti-codon sequence on...
3. What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct amino acid? 6. If each amino acid was encoded by a single codon, what is the minimum number of amino-acyl tRNA synthetases required for translation? 7. Looking at the codon table, if there was a unique aminoacyl-tRNA synthetase required for each anticodon, what is the minimum required? 9. If an aminoacyl-tRNA synthetase recognized any nucleotide (purine or pyrimidine) in the 5’end of the anticodon,...
I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 11 21 31 41 51 71 81 61 91 CGTAATTGAG GAGGTAGTTG ACGTATGAAT AGTTAACGTA CGGGGGGGAA 101 111 121 131 141 ACCCCCCCTT TTTTTTTTTC GAGCAATAAA AGGGTTACAG ATTGCATGCT a) Write down the corresponding sequences, find them in the sequence above and label them: -35 Consensus sequence: _(label as -35) -10 Consensus sequence (Pribnow box): _ __ (label as Pribnow) Shine-Dalgarno sequence in corresponding mRNA: __ (label as SD)...
Which of the following is not an RNA sequence that is recognized by the spliceosome during the process of splicing? O A. The 5' splice site OB. The 3' splice site o C. The promoter OD. The branch point O E. All of the above are recognized by the spliceosome What is the role of the Shine-Dalgarno sequence near the 5' end of prokaryotic mRNAS? O A. It is the sequence recognized by IF-2 OB. It establishes the position of...
C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
Use this DNA sequence to answer these five questions T A CGGGACATAG Choose mplementary sequence of mRNA bases tRNA anticodon bases complementary sequence of DNA bases sequence which complements the mRNA Choose... Choose.. Choose.. Choose Met-Pro-Cys-lleu ATG CCCTGTATC UACGGGACAUAG sequence of amino acids which would result during translation A U C age
Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...
Below is a partial mRNA sequence. Use it to answer the following questions. 5 - UGGUCGGCGAGAACGAAAGCGC - 3 The amino acids in the original partial sequence (N-term-...V-G-E-N-E-S...-C-term) have little to no impact on protein structure and function, with the exception of serine. Phosphorylation of the serine residue is required for normal function of the protein. Given this information, which reversion mutation(s) in the gene would restore the normal function of the entire protein? Select the four correct answers. Deletion of...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
21. The initiation of transcription of a gene occurs DNA when RNA polymerase binds to the of the gene b. start codon c. exon 1 d. intron 1 e. splice site 22. Phosphodiester linkages are present in a. DNA b. mRNA c. tRNA d a and b e. all of the above 23. The 5' cap and poly A tail are added to a. pre-mRNA in the cytoplasm b. help with pre-mRNA splicing. c. protect mRNA d. assist in posttranslation...
Student Sheet Name Title: Making Sentences of DNA structions coded in DNA in this activity yoids. The words Introduction: The instructions coded in DNA must be read and turned into pro molecules for the cell to carry out the instructions. In this activity you will model this process using sentences for DNA and RNA and words for amino acids. The words must line up in the correct order for the protein to form properly, just like words in a sentence...