ZuoTi.Pro
Question

Use this DNA sequence to answer these five questions T A CGGGACATAG Choose mplementary sequence of mRNA bases tRNA anticodon bases complementary sequence of DNA bases sequence which complements the mRNA Choose... Choose.. Choose.. Choose Met-Pro-Cys-lleu ATG CCCTGTATC UACGGGACAUAG sequence of amino acids which would result during translation A U C age

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

mRNA., AUG CCC UGU AUC tRNA → UAC Coaon 把onine Amino auid

0 0
Add a comment
Know the answer?
Add Answer to:
Use this DNA sequence to answer these five questions T A CGGGACATAG Choose mplementary sequence of...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1)....

    In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL LETTERS (e.g., GGCGGT), and work your way from the top to the bottom. A) Fill in the complementary DNA bases for DNA Strand 2 to form a complete double-stranded DNA molecule. B) Create an mRNA strand that is complementary to DNA Strand 1. C) Using the mRNA sequence that you just created, determine the complementary...

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your...

    DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...

  • Date Per Practicing DNA Transcription and Translation For the following examples, give the appropriate sequence of...

    Date Per Practicing DNA Transcription and Translation For the following examples, give the appropriate sequence of DNA, mRNA, TRNA and/or polypeptide (AA : amino acids). Remember A codon chart can only be used for decoding a strand of mRNA Codon Chart a THrd DNA: TAC GCG CCT AGG 6GG TGG mRNA: DNA: TTC GAT TAG ATG CCG AAG mRNA: tRNA: - - DNA: mRNA:

  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...

    The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...

  • For Questions 8-13, match the term with its definition. A. polypeptide B. genetic code C. codon...

    For Questions 8-13, match the term with its definition. A. polypeptide B. genetic code C. codon D. translation _8. The sequence of bases that serves as the language of life _9. A sequence of 3 bases on a tRNA molecule that is complementary to sequences of bases on an mRNA molecule. 10. How genetic information is put into action in a I living cell 11. The decoding of an mRNA into a protein 12. A chain of amino acids 13....

  • the several other 10.4 to show t 3. The base uracil substitutes for the base thymine in RNA. Complete Table ways...

    the several other 10.4 to show t 3. The base uracil substitutes for the base thymine in RNA. Complete Table ways RNA differs from DNA Table 10.4 DNA Structure Compared with RNA Structure RNA Sugar Bases Strands Helix DNA Deoxyribose Adenine, guanine, thymine, cytosine Double stranded with base pairing Yes Complementary Base Pairing Complementary base pairing occurs between DNA and RNA. The RNA base uracil pairs with the DNA base adenine; the other bases pair as shown previously. Complete Table...

  • 5. If a mutation happens in the DNA that changes the T at base 14 to a G:

    Genetic Code: The dictionary of the language of life Use the Genetic Code as a "dictionary" to solve the exercises on next page 5. If a mutation happens in the DNA that changes the T at base 14 to a G: a) What would be mutated sequence of nucleotides in the corresponding codon in the mRNA and the anticodon in the tRNA? Is there any change in the corresponding amino acid in the protein?  b) What is the name of this type of...

  • 2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...

    2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT