Question

Below is a partial mRNA sequence. Use it to answer the following questions.

5 - UGGUCGGCGAGAACGAAAGCGC - 3

The amino acids in the original partial sequence (N-term-...V-G-E-N-E-S...-C-term) have little to no impact on protein structure and function, with the exception of serine. Phosphorylation of the serine residue is required for normal function of the protein.

Given this information, which reversion mutation(s) in the gene would restore the normal function of the entire protein?
Select the four correct answers.

Deletion of 1 base-pair in the region of the valine codon
Insertion of 1 base-pair in the region of the valine codon
Deletion of 2 base-pairs in the region of the valine codon
Deletion of 5 base-pairs in the region of the valine codon
Insertion of 2 base-pairs in the region of the valine codon
Insertion of 4 base-pairs in the region of the valine codon

Answer 1

Answer) We have a partial mRNA sequence as following;
5 - UGGUCGGCGAGAACGAAAGCGC - 3

and the amino acids in the original partial sequence as following;

N-term-...V-G-E-N-E-S... -C-term

and we are given that this sequence has little to no impact on protein structure and function, except for serine. Phosphorylation of the serine residue is required for normal function of the protein. it means that except serine, none of the given amino acid has any important role.

and we are asked that which reversion mutation(s) in the gene would restore the normal function of the entire protein?

as we know that reversion mutations are the ones which are exactly opposite to the early mutation in terms of quality and quantity. which means deletion and insertion of same number of base pairs at a given position are the reversion mutations. i.e. deletion of 2 bp and insertion of 2bp at the same amino acid position are the reversion mutations.

this way, there are 4 possible reversion mutation in the given case (out of the given list above);

Deletion of 1 base-pair in the region of the valine codon
Insertion of 1 base-pair in the region of the valine codon
Deletion of 2 base-pairs in the region of the valine codon
Insertion of 2 base-pairs in the region of the valine codon

This is because deletion of 1bp or 2bp are the reversion mutations for the insertion of 1bp or 2bp and vice versa.