Question

21. The initiation of transcription of a gene occurs DNA when RNA polymerase binds to the of the gene b. start codon c. exon 1 d. intron 1 e. splice site 22. Phosphodiester linkages are present in a. DNA b. mRNA c. tRNA d a and b e. all of the above 23. The 5 cap and poly A tail are added to a. pre-mRNA in the cytoplasm b. help with pre-mRNA splicing. c. protect mRNA d. assist in posttranslation e all of the above 24. The genetic code is best described as a. degenerate but not ambiguous. b. ambiguous but not degenerate. c. both ambiguous and degenerate. d. neither ambiguous nor degenerate. e. degenerate in prokaryotes, but ambiguous in eukaryotes. of the anticodon, and helps explain why the end of 25. The wobble phenomenon occurs at codon shows the most redundancy a. the 5 end; 3 b. the 3 end; 5 c. the 3 end; 3 d. the 5 end; 5 e, either end; 5 26. Which of the following would be an example of an unambiguous genetic code? a. One with 61 codons for 20 amino acids b. One in which UUU only code for phenylalanine c. One in which CCU could code for either alanine or leucine d. All of the above e. None of the above
0 0
Add a comment Improve this question Transcribed image text
Answer #1

21. a. promoter

The RNA polymerase binds to the promoter region of the DNA.

22. e. all of the above

A phosphodiester bond is the linkage between the 3' carbon atom of one sugar molecule and the 5' carbon atom of another, deoxyribose in DNA and ribose in RNA.

23. c. protect mRNA

During pre-mRNA processing, a 7-methylguanosine cap is added to the 5′ end and a string of approximately 200 A nucleotides, called the poly (A) tail, is added to the 3′ end of the pre-mRNA. These protect the mRNA from degradation, aid in the export of the mature mRNA to the cytoplasm, and help in initiating translation.

24. a. degenerate but not ambiguous

The genetic code is degenerate (more than one codon may specify a particular amino acid) but not ambiguous (no codon specifies more than one amino acid)

25. c. the 3' end: 3'

26. b. One in which UUU only code for phenylalanine

Add a comment
Know the answer?
Add Answer to:
21. The initiation of transcription of a gene occurs DNA when RNA polymerase binds to the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • 6:35 5 minutes ago 25) Which of the following turns off transcription by binding to the operator? A) repressons B) lactose C) RNA polymerase D) promoters E) enzymes 25) 26) In bacteria, what n...

    6:35 5 minutes ago 25) Which of the following turns off transcription by binding to the operator? A) repressons B) lactose C) RNA polymerase D) promoters E) enzymes 25) 26) In bacteria, what name is given to a cluster of genes with related functions, along with their control 26) A) exon B) operon C) promoter D) activator E) regulatory gene A mutant bacterial cell has a defective aminoacyl synthetase that attaches a lysine to tRNAs with the anticodon AAA instead...

  • 70. RNA synthesis in bacteria requires which of the following? a. DNA polymerase III b. A...

    70. RNA synthesis in bacteria requires which of the following? a. DNA polymerase III b. A primer c. A DNA template d. DNA Gyrase e. Deoxyribonucleotide triphosphate 86. Two phenotypically normal people have 4 children. 3 are phenotypically normal like their parents, but one is an albino. What are the probable genotypes of the parents? a. Both parents are homozygous dominant b. Both parents are homozygous recessive c. One parent is homozygous dominant and the other is homozygous recessive d....

  • 50) During DNA DNA? replication, which of the following enzymes covalently connects segments of A) helicase...

    50) During DNA DNA? replication, which of the following enzymes covalently connects segments of A) helicase B) DNA polymerase III C) ligase D) DNA polymerase I E) primase 51) The nitrogenous base adenine is found in all members of which of the following groups of molecules? A) proteins, triglycerides, and testosterone B) proteins, ATP, and DNA C) ATP, RNA, and DNA D) glucose, ATP, and DNA E) proteins, carbohydrates, and ATP 52) A particular triplet of bases in the template...

  • Below is the genomic DNA of gene X, a 3 exon gene that encodes a 131 amino acid single pass trans...

    why is E the answer Below is the genomic DNA of gene X, a 3 exon gene that encodes a 131 amino acid single pass transmembrane protein. Shown are the transcriptional start site, splice donor, acceptor and branch sites and translational start and stop codons. Transcriptional start EXON 1 INTRON 1 EXON 2 INTRON 2 EXON 3 Spfice Donor Splice Acceptor Polyadenylation signal Branch point 17. Treatment with ethidium bromide, an intercalating agent, caused DNA polymerase to add an extra...

  • Prokaryotic transcription initiation occurs when RNA polymerase binds to promoter region. A hairpin loop is formed....

    Prokaryotic transcription initiation occurs when RNA polymerase binds to promoter region. A hairpin loop is formed. Replication forks are created. DNA polymerase binds to promoter region. Flag this Question Question 8 2 pts The movement of genetic information between organisms is termed __________. genetic engineering. transfection. translocation. gene transfer. Flag this Question Question 9 2 pts Heterotrophs cannot synthesize organic molecules on their own. manufacture their own food. include two of the choices. include all the choices. can be chemoheterotrophs....

  • 4. Which form of DNA is possible as well as the linear form? a. circular b....

    4. Which form of DNA is possible as well as the linear form? a. circular b. stem loop c. A-DNA d. supercoiled e. B-DNA 5. Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA? a. If the mutation occurs in the exon, it will not affect the gene product. b. If the mutation occurs in the 3′ end of the start site, it will not affect the gene product. c. If the...

  • 27. RNA Polymerase ence of DNA that controls gene expression G. binds an operator and stops...

    27. RNA Polymerase ence of DNA that controls gene expression G. binds an operator and stops gene expression in LAC operon by preventing RNA polymerase from binding gene and transcribing. H. Duplication of DNA in Sphase of Interphase 28. Codon 29. Transgenic 30. Recombinant DNA 31. PCR 32. 33 34. 35. 36. 37. 38. Plasmid Gene Therapy Gel electrophoresis DNA Profile DNA ligase GMO concern GMO benefit A. Analyzing STR patterns of blood or hair samples to solve crimes B....

  • 25. What binds to a stop codon on a mRNA during translation? a. transcription factor c....

    25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...

  • 2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...

    2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT