In the given molecular diagram of DNA , total of 4 base pairs are represented. They are:
T= A (double bond)
C_=G ( triple bond )
A=T ( double bond)
G_=C ( triple bond )
3' end 5' end 5' end 3 end DNA Strand 2 In this DNA molecule diagram,...
3 end 5 end A B 5 end 3' end DNA Strand 2 С In this DNA molecule diagram, which labeled structure represents the represents the phosphate on the backbone?
Draw a DNA molecule containing four base pairs. Identify the 5' end and the 3' end of each strand. Identify the Hydrogen bonds that hold the molecule together.
the options are : leading strand, 5’end of new DNA strand, 3’ end of new DNA strand, 5´end of parentsl DNA strand, RNA primer, 3’ end of parental DNA strand, RNA transcript, lagging strand and DNA. The image below shows DNA replication; certain parts of the image are labelled with letters. Match the letter to its correct will be used). B. 5' end of parental DNA strand 3' end of parental DNA strand leading strand RNA primer
The following figure shows a simplified diagram of part of a DNA molecule. a. Identify the parts of the DNA molecule labelled A to C in the figure above. (3 marks) b. The table below shows the results of an analysis of the base composition for each strand of a DNA molecule. Complete the table by adding the missing values for strands 1 and 2. (5 marks) Percentage of each base DNA strand А Тc TG Strand 1 3522 Strand...
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
please help The following diagram shows a fragment of transcribed DNA, and the upper strand is the non-template strand: 5 TAACGG 3 3' ATTGCC 5 The transcribed RNA can be represented by? d. 5' UAACGG 3 c. 5' AUUGCC 3 O O b. 5 TAACGG 3 a. 5' AUUGCC 3 The primary structure of a polypeptide is: O a) the sequence of nucleotides on the DNA molecule that encodes the protein. b) the linear sequence of amino acids that constitutes...
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-AGGCCTT-3 Number As a result of rotation about six of its bonds, DNA can exist in a variety of forms. Determine whether each of the following images and properties describes the A form, B form, or Z form of DNA. A form B form Z form All antiparallel strands left-handed C-3' of deoxyribose 18.4 A is out of the plane of helix diameter the other ring atoms...
21. In DNA replication, new nucleotides are added a. To the 5' end of each nascent strand b. To the 3'end of each nascent strand To both ends of each nascent strand d. To the 5' end of the continuous strand and the 3' end of the discontinuous strand e. To the end of the continuous strand and the end of discontinuous strand fragments 22. DNA unwinding is done by a. Ligase b. Helicase c. Topoisomerase dHexonuclease 23. Proofreading of...
Why does a new DNA strand elongate only in the 5' to 3' direction during DNA replication? The polarity of the DNA molecule prevents addition of nucleotides at the 3' en Replication must progress toward the replication fork. DNA polymerase can add nucleotides only to the free 3' end. DNA polymerase begins adding nucleotides at the 5' end of the template,
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS