Homework Answers
Add Answer to:
Draw a DNA molecule containing four base pairs. Identify the 5' end and the 3' end...
5) ____________________ bonds hold DNA base pairs together and ______________________ bonds form the DNA backbone. (a)...
5) ____________________ bonds hold DNA base pairs together and ______________________ bonds form the DNA backbone. (a) phosphodiester, hydrogen (b) van der Waals, hydrogen (c) ionic, phoshodiester (d) hydrogen, phosphodiester
3' end 5' end 5' end 3 end DNA Strand 2 In this DNA molecule diagram,...
3' end 5' end 5' end 3 end DNA Strand 2 In this DNA molecule diagram, how many base pairs are represented? 2 4 8 24
Which of the following is true? a. The two strands of a DNA molecule are held...
Which of the following is true? a. The two strands of a DNA molecule are held together by covalent bonds. b. Hydrogen bonding between complementary base pairs causes the DNA molecule to twist into a spiral. c. A single strand within a DNA molecule is held together by hydrogen bonds. d. The bases on one strand of DNA are held to the bases on the other strand by hydrogen bonds.
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine...
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine remember there are 2 nucleotides in a base pair 1, How many H bonds hold the strands together? 2. How many purines are in the molecule? 3. How many pyrimidines in this molelcule? 4 Would you expect this strand to "melt" at a higher or lower temperature than AT rich DNA?
The following figure shows a simplified diagram of part of a DNA molecule. a. Identify the...
The following figure shows a simplified diagram of part of a DNA molecule. a. Identify the parts of the DNA molecule labelled A to C in the figure above. (3 marks) b. The table below shows the results of an analysis of the base composition for each strand of a DNA molecule. Complete the table by adding the missing values for strands 1 and 2. (5 marks) Percentage of each base DNA strand А Тc TG Strand 1 3522 Strand...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
A 100 base pair double strand is 20% A (remember base pairs) 1. How many bases...
A 100 base pair double strand is 20% A (remember base pairs) 1. How many bases ( in number) are T? 2. What percentage of bases are C? 3. How many hydrogen bonds hold the strands together?
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a....
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...
2) Draw the two base-pairs, A-T and G-C, depicting the nitrogen-containing bases attached to the deoxyribose-phosphate...
2) Draw the two base-pairs, A-T and G-C, depicting the nitrogen-containing bases attached to the deoxyribose-phosphate backbone of DNA. Include the hydrogen bonding sites. (Hint: Look at Figure 12.7, Chemistry in Context 7h Edition). A-T base-pairing (show the Hydrogen bonding): G-C base-pairing (show the Hydrogen bonding): 101 Oy. The process CH3 thymine 0----H-N HC adenine N- To deoxyribose and DNA chain To deoxyribose and DNA chain N -H cytosine HC-C guanine HC N To deoxyribose and DNA chain To deoxyribose...
DNA Worksheet DNA by the numbers : Write the correct number in each blank ( when...
DNA
Worksheet
DNA
by the numbers : Write the correct number in each blank ( when
necessary, assume we are talking about B DNA).
________ DNA strands in a double helix
________ hydrogen bonds in an A-T base pair
________ hydrogen bonds in a G-C base pair
_______nucleotides in one turn of a double helix
____nm between two bases on a strand of DNA
________ nm in one turn of a double helix
________ nm in diameter
________ the end...
3' end 5' end 5' end 3 end DNA Strand 2 In this DNA molecule diagram, how many base pairs are represented? 2 4 8 24
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine remember there are 2 nucleotides in a base pair 1, How many H bonds hold the strands together? 2. How many purines are in the molecule? 3. How many pyrimidines in this molelcule? 4 Would you expect this strand to "melt" at a higher or lower temperature than AT rich DNA?
The following figure shows a simplified diagram of part of a DNA molecule. a. Identify the parts of the DNA molecule labelled A to C in the figure above. (3 marks) b. The table below shows the results of an analysis of the base composition for each strand of a DNA molecule. Complete the table by adding the missing values for strands 1 and 2. (5 marks) Percentage of each base DNA strand А Тc TG Strand 1 3522 Strand...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
A 100 base pair double strand is 20% A (remember base pairs) 1. How many bases ( in number) are T? 2. What percentage of bases are C? 3. How many hydrogen bonds hold the strands together?
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...
2) Draw the two base-pairs, A-T and G-C, depicting the nitrogen-containing bases attached to the deoxyribose-phosphate backbone of DNA. Include the hydrogen bonding sites. (Hint: Look at Figure 12.7, Chemistry in Context 7h Edition). A-T base-pairing (show the Hydrogen bonding): G-C base-pairing (show the Hydrogen bonding): 101 Oy. The process CH3 thymine 0----H-N HC adenine N- To deoxyribose and DNA chain To deoxyribose and DNA chain N -H cytosine HC-C guanine HC N To deoxyribose and DNA chain To deoxyribose...
DNA
Worksheet
DNA
by the numbers : Write the correct number in each blank ( when
necessary, assume we are talking about B DNA).
________ DNA strands in a double helix
________ hydrogen bonds in an A-T base pair
________ hydrogen bonds in a G-C base pair
_______nucleotides in one turn of a double helix
____nm between two bases on a strand of DNA
________ nm in one turn of a double helix
________ nm in diameter
________ the end...
Most questions answered within 3 hours.
-
1.Design a Schmidt Trigger circuit using the LM311N comparator
IC that will illuminate an LED (your...
asked 42 seconds ago -
1.) As the average hourly wage increases from
$22 per hour to $28 per hour, the...
asked 6 minutes ago -
One tablet of Tums contains 350.0 mg of CaCo3. If 4 tablets of
Tums is added...
asked 14 minutes ago -
Jason Allen is saving for an Australian vacation in three years.
He estimates that he will...
asked 35 minutes ago -
starting in the radial vein list in order all the vessels through
which an erythrocyte will...
asked 41 minutes ago -
Management at Work
As the training and development manager at the Litter*Bit*Better
Cat Litter Company, part...
asked 43 minutes ago -
What is the significance of the constraints in a physical model?
What part do distinct constraints...
asked 1 hour ago -
a student was diagnosed with myopia (nearshightedness). He can
comfortably read a newspaper when it is...
asked 1 hour ago -
Consider a 3m x 3m window in a house. The thermal conductivity
is reported to be...
asked 2 hours ago -
Why has California been the favorite destination of large number
of secondary migrants?
asked 2 hours ago -
Do not neglect the old for the new. The existing business must
not lose priority simply...
asked 5 hours ago -
Kylie is a single mom with two dependent children,
Tanner, age 7 and Olivia, age 11....
asked 7 hours ago