17. When is heterochromatin formation advantageous for an individual? A. When it inactivates Beta-globingene B. When...
17. When is heterochromatin formation advantageous for an individual?
A. When it inactivates Beta-globingene
B. When it inactivates an X-chromosome
C. When it forms in the coding region of an essential gene
D. When it forms in the regulatory sequence of an essential gene
Homework Answers
B is correct answer because females have two X chromosome so one X chromosome should be inactivated. This one X chromosome is inactivated by formation of heterochromatin to that X chromosome..
Add Answer to:
17. When is heterochromatin formation advantageous for an
individual?
A. When it inactivates Beta-globingene
B. When...
When is heterochromatin formation advantageous for an individual? A. When it inactivates -globin gene B. When...
When is heterochromatin formation advantageous for an individual? A. When it inactivates -globin gene B. When it inactivates an X-chromosome C. When it forms in the coding region of an essential gene C. When it forms in the regulatory sequence of an essential gene
X-inactivation A).Occurs randomly in both males and females. B).Occurs in gamates just after their formation. C).Inactivates...
X-inactivation A).Occurs randomly in both males and females. B).Occurs in gamates just after their formation. C).Inactivates only recessive alleles of genes on the X-chromosome. D).May inactivate in either the paternal or maternal X-chromosome.
In eukaryotic genomes, regions of _____________________ are transcriptionally active while regions of ____________________ are transcriptionally silent....
In eukaryotic genomes, regions of _____________________ are transcriptionally active while regions of ____________________ are transcriptionally silent. A) Heterochromatin; euchromatin B) Euchromatin; heterochromatin C) None of the above Which of the following proteins can regulate eukaryotic gene expression WITHOUT binding to the DNA in the regulatory region? A) repressors B) enhancers C) co-activators D) transcription factors In eukaryotes, transcriptional activity can be regulated by methylation of a dinucleotide sequence called "CpG." This modification occurs at a: A) Adenine B) Cytosine C)...
onaformation from a ee is used in the synthesisof 17 functional gene product. A) Geno B)...
onaformation from a ee is used in the synthesisof 17 functional gene product. A) Geno B) Gene regulation C) Epigenetics D) Imprinting E) Chromatin remodeling 18. A histone code is the: A) B) nucleotide sequence of an individual histone protein's gene. pattern of chemical modification of the DNA wrapped around an individual histone. C) D) E) pattern of chemical modification of the histone tails. number of amino acids in an individual histone that are methylated None of the other answer...
In the case of directional selection, if the advantageous allele (b) is recessive and a less...
In the case of directional selection, if the advantageous allele (b) is recessive and a less advantageous allele (B) is dominant: A. b will be lost in the population because the dominant allele will increase in frequency by natural selection B. b will increase in frequency at the same speed as if it was a dominant advantageous allele, because what matters is the coefficient of selection and not if the allele is dominant or recessive C. b will increase in...
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding...
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X
ԿԱՆՉՈ» 2. Genes are made of DNA nucleotides. The gene for the beta chain of hemoglobin...
ԿԱՆՉՈ» 2. Genes are made of DNA nucleotides. The gene for the beta chain of hemoglobin is 1,734 nucleotides in length and is located on the human chromosome 11. The mutation responsible for sickle-cell anemia affects a single nucleotide, which in turn changes a single amino acid. (9 pt) a. How are these nucleotides joined together to form a long polynucleotide chain? Name the relevant nucleotide constituents important for making the linkage. (see Slides 5-7 of Lecture 4b) (2 pt)...
Inversion Problems: An individual is heterozygous for an inversion: ADCBEFG HI, and during gamete formation there...
Inversion Problems: An individual is heterozygous for an inversion: ADCBEFG HI, and during gamete formation there is a crossing over event between C and B. Draw chromosome structure pre and post meiosis. Be sure to label the chromatids/chromosomes with the appropriate sequence of genes. Label mutant and wild type chromatids/chromosomes, viable and non-viable gametes. Circle and identify the mutations in the non-viable gametes inuerston If an individual is heterozygous for an inversion, ABC DGFEHI, and a crossing over event occurred...
e. have several chromosomes. team of biologists collects samples from a stream. Using PCR and other...
e. have several chromosomes. team of biologists collects samples from a stream. Using PCR and other techniques umerous DNA sequences. In doing so, they discover many new bacterial species working in the field of niques, they amplify . T a. metagenomics. b. junctional genomics. c.comparative genomics. d. relational genomics. e. proteomics. tarting with Mycoplasma genitalium, how was the minimal genome size of bacteria experimentally ssessed? a. By knocking genes out with transposons; if bacteria survived despite the gene being knocked...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1)...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
onaformation from a ee is used in the synthesisof 17 functional gene product. A) Geno B) Gene regulation C) Epigenetics D) Imprinting E) Chromatin remodeling 18. A histone code is the: A) B) nucleotide sequence of an individual histone protein's gene. pattern of chemical modification of the DNA wrapped around an individual histone. C) D) E) pattern of chemical modification of the histone tails. number of amino acids in an individual histone that are methylated None of the other answer...
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X
ԿԱՆՉՈ» 2. Genes are made of DNA nucleotides. The gene for the beta chain of hemoglobin is 1,734 nucleotides in length and is located on the human chromosome 11. The mutation responsible for sickle-cell anemia affects a single nucleotide, which in turn changes a single amino acid. (9 pt) a. How are these nucleotides joined together to form a long polynucleotide chain? Name the relevant nucleotide constituents important for making the linkage. (see Slides 5-7 of Lecture 4b) (2 pt)...
Inversion Problems: An individual is heterozygous for an inversion: ADCBEFG HI, and during gamete formation there is a crossing over event between C and B. Draw chromosome structure pre and post meiosis. Be sure to label the chromatids/chromosomes with the appropriate sequence of genes. Label mutant and wild type chromatids/chromosomes, viable and non-viable gametes. Circle and identify the mutations in the non-viable gametes inuerston If an individual is heterozygous for an inversion, ABC DGFEHI, and a crossing over event occurred...
e. have several chromosomes. team of biologists collects samples from a stream. Using PCR and other techniques umerous DNA sequences. In doing so, they discover many new bacterial species working in the field of niques, they amplify . T a. metagenomics. b. junctional genomics. c.comparative genomics. d. relational genomics. e. proteomics. tarting with Mycoplasma genitalium, how was the minimal genome size of bacteria experimentally ssessed? a. By knocking genes out with transposons; if bacteria survived despite the gene being knocked...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
Most questions answered within 3 hours.
-
Industry: Telecommunications in India
Here, you need to discuss the sources of the growth pattern
and...
asked 1 hour ago -
Hydrobromic acid
dissolves solid iron according to the followiaung reaction:
Fe(s)+2HBr(aq)→
FeBr2(aq)+ H2(g)
Part A. What...
asked 3 hours ago -
Verify the following vector identity in SPHERICAL
COORDINATES.
div(curl(A)) = 0
asked 4 hours ago -
The work function (Φ) for a metal is 7.50×10-19 J.
What is the longest wavelength (nm)...
asked 5 hours ago -
1. Would the following procedural changes cause the
calculated mass percent Ni2+ ion in Ni(NH3)nCl2 to...
asked 6 hours ago -
1. Why does the voltage of the capacitor vary with frequency?
where does this missing voltage...
asked 8 hours ago -
p p please write each step out clearly
3. A manager of a company is considering...
asked 7 hours ago -
On October 1, Ebony Ernst organized Ernst Consulting; on October
3, the owner contributed $83,540 in...
asked 8 hours ago -
A.)As an electron moves through a region of space, its speed
decreases from 9.60 × 106...
asked 8 hours ago -
In java with the netbeans program do:
Through object programming
Create a class "ContadorP", which is...
asked 8 hours ago -
Pattern Corporation acquired all of Science
Company's outstanding stock on January 1, 2016 for $600,000 cash....
asked 8 hours ago -
Here are all accounts Tyler Co. maintains.
Tax expenses $4,750
Common stocks $48,840
SG&A expenses $2,500...
asked 9 hours ago