A. Nucleotides in a polynucleotide chain are connected to each other by phosphodiester Bond. Phosphodiester bond is the type of covalent bond which is formed between 5' phosphate group of one nucleotide and 3' hydroxyl group of the other nucleotide.
B. In this sequence, there are 15 nucleotides. The number of nucleotides is equal to the number of nitrogenous bases present in a given sequence. At 5 prime end, phosphate group is present whereas at 3 prime end hydroxyl group is present.
C. The Other strand will be opposite in direction and complementary to the given strand.
3' TGAGGACTCCTCTTC 5'
D. If we compare the mutant sequence with the wild type sequence, then we can see that eight nucleotide in the wild type sequence is adenine and in the mutant it is changed to thymine. This mutation is changing the nitrogenous base of the nucleotide.
E. Hydrogen bonds present between complementary bases. These bonds are not present in RNA because it is mostly single stranded in nature. But it is double stranded sometimes, than hydrogen bonds are present.
Please rate high.
ԿԱՆՉՈ» 2. Genes are made of DNA nucleotides. The gene for the beta chain of hemoglobin...
11. A gene is best defined as a. A segment of DNA b. Three nucleotides that code for an amino acid. C. A sequence of nucleotides in DNA that codes for a functional product. d. A sequence of nucleotides in RNA that codes for a functional product. e. A transcribed unit of DNA. 12. Which of the following statements is false? a. DNA polymerase joins nucleotides in one direction only. b. The leading strand of DNA is made continuously c....
The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select all of the options below that are true. 1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...
The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C
5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts) ATTGCCAGATCATCCCAATAGAT Label the 5’ and 3’ ends of the DNA template. (1 pt) b) Give the sequence and label the 5’ and 3’ ends of the RNA transcribed from this template. (2 pts)
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...
1. Factors that contribute to the mutation rate of any gene include: Choose all correct. A. The size of the gene B.The protein the gene will give rise to after translation C.The nucleotide sequence (DNA or mRNA) D.Spontaneous chemical changes E. The location of the gene on the chromosome (What is the correct answer) 2.Trinucleotides are really just: A. A codon that will be read and converted into a single amino acid in a protein sequence B.A piece of DNA...
Original DNA sequence (coding strand), starting at the beginning of the gene: Normal: 5'-ATGATCTCCTAATACAA... Mutation: 5'-TTGATCTCCTAATACAA... 30. Can a single nucleotide be a conserved sequence? Explain your answer. (4 Points) 31. Explain why self-splicing introns support the RNA world first Hypothesis (life evolved via RNA). (3 Points)
Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...
1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...