Below are sequences from two individuals at two different genomic loci. Locus 1: Individual 1: TCGCATCTAGCTCAT...
Below are sequences from two individuals at two different genomic loci.
Locus 1:
Individual 1: TCGCATCTAGCTCAT
Individual 2: TCGCATCGAGCTCAT
Locus 2:
Individual 1: CGATCGAGAGAGATCGATCGTAGCTCG
Individual 2: CGATCGAGAGAGAGAGAGAGAGAGAGATCGATCGTAGCTCG
1) At locus 1, _______ allele(s) are likely present in human populations.
A) one
B.two
C.three
D.four
E. multiple
2) At locus 2, _______ allele(s) are likely present in human populations.
A) one
B.two
C.three
D.four
E. multiple
Homework Answers
Add Answer to:
Below are sequences from two individuals at two different
genomic loci.
Locus 1:
Individual 1: TCGCATCTAGCTCAT...
Question 4 (1 point) Two loci are linked to each other. The Red hair locus is...
Question 4 (1 point) Two loci are linked to each other. The Red hair locus is complete dominant in that the dominant allele (R) provides an individual with non-red hair and the recessive allele (r) provides an individual with red hair. The Freckles locus is completely dominant in that the dominant allele (F) codes for freckles and the recessive allele (f) doesn't cause freckles. You often see red hair and freckles occurring together, suggesting the two loci are linked. Provided...
(1) One of the standard techniques to determine whether two loci are physically close to one anot...
Hello, please show work :) . I want to double check my work
and answers . thanks
(1) One of the standard techniques to determine whether two loci are physically close to one another on the same chromosome is to conduct a "dihybrid cross", a cross of two individuals that are heterozygous at both loci. For example if the two loci have alleles A and a at the first locus and B and b at the second locus then crossing...
Question 27 3 pts The character matrix below displays the genetic sequences for 5 different species....
Question 27 3 pts The character matrix below displays the genetic sequences for 5 different species. Each genetic locus can be considered an independent character with four possible states: A, C, G, or T. Which of the following sets of loci are parsimony uninformative? Locus 1 2 3 4 5 6 Species A ATG ACA Species B A CGGCT Species C ATCTAA Species D ACG CAT | Species E ACG G TI 0 Locus 1 Loci 1.3.4 Loci 1.3 Loci...
There is a two locus, two allele system where the ‘E’ locus codes for flower color...
There is a two locus, two allele system where the ‘E’ locus codes for flower color and (EE) gives red flowers and (ee) gives white flowers and (E) is dominant. The second locus controls seed color and has two alleles, (YY) gives yellow seeds and (yy) gives green seeds and (Y) is dominant. Assuming these loci are on different chromosomes (that is, they are unlinked) what will be the genotype frequencies of the offspring be in a cross between EE...
Each human α-globin locus contains two α-globin genes, α1 and α2, and most individuals have two...
Each human α-globin locus contains two α-globin genes, α1 and α2, and most individuals have two copies of the locus. Which of the genotypes would result in the most severe phenotype? (A"–" represents a deletion allele.) Select one: a. α1 – / α2 – b. α1 – / α2 α2 c. α1 α1 / – – d. α1 α1 / α2 α2 e. α1 – / – –
Consider a locus of interest that has two alleles: A and a. A diploid individual carrying...
Consider a locus of interest that has two alleles: A and a. A diploid individual carrying these alleles can have one of three genotypes: AA, Aa, or aa; a population will consist of some combination of AA, Aa, and aa individuals. The relatively frequency of each of these genotypes makes up the population's structure. Hardy and Weinberg independently figured out that, in the absence of forces that cause evolutionary change, the population structure will 'settle' or default to equilibrium values,...
For this question, we consider a two-allele, one locus trait. Here, assume the trait that this...
For this question, we consider a two-allele, one locus trait. Here, assume the trait that this locus affects is coat thickness. In a juvenile population of bison, they commonly experience a harsh winter. The AA individuals lose about 50% of their number, the Aa individuals lose about 30%, and the aa individuals lose about 90% of their number. Before the winter, there are 1000 AA individual, 300 Aa individuals, and 700 aa individuals (generation 1). a) What are the relative...
1) You have two human liver cells (A and B) and you hypothesize that the insulin...
1) You have two human liver cells (A and B) and you hypothesize that the insulin receptor gene in Cell A has a mutation in exon 1 and Cell B contains the wild type sequence. You extract genomic DNA from each of the cells. Of the following, what would be the most efficient (quick, precise and relatively cheap) way to test your hypothesis. a. Isolate protein from both cells, purify the insulin receptor, and determine the amino acid content. b. Sequence the...
When there is a match between a forensic DNA sample collected at a crime scene and...
When there is a match between a forensic DNA sample collected
at a crime scene and DNA subpoenaed from a suspect, the genotype
frequency can be interpreted in two ways. In one sense, it is the
probability of finding that specific genotype in the population. In
another sense it is the probability that the match is due to
chance.
How does the results from the most common alleles in
the different populations affect the application of using these
results for...
central dogma question The nucleotide sequence below is from an individual. Only one strand of the...
central dogma question
The nucleotide sequence below is from an individual. Only one strand of the chromosome is shown. Write the complementary strand of the DNA below. Watch your polarity! Below are two sequences, A and B. Both of these sequences are from the same gene from two different individuals. Differences in their sequence are highlighted red. What do these two sequences (A and B) represent? Now predict what a DNA gel of digested DNA from individual A and B...
Question 4 (1 point) Two loci are linked to each other. The Red hair locus is complete dominant in that the dominant allele (R) provides an individual with non-red hair and the recessive allele (r) provides an individual with red hair. The Freckles locus is completely dominant in that the dominant allele (F) codes for freckles and the recessive allele (f) doesn't cause freckles. You often see red hair and freckles occurring together, suggesting the two loci are linked. Provided...
Hello, please show work :) . I want to double check my work
and answers . thanks
(1) One of the standard techniques to determine whether two loci are physically close to one another on the same chromosome is to conduct a "dihybrid cross", a cross of two individuals that are heterozygous at both loci. For example if the two loci have alleles A and a at the first locus and B and b at the second locus then crossing...
Question 27 3 pts The character matrix below displays the genetic sequences for 5 different species. Each genetic locus can be considered an independent character with four possible states: A, C, G, or T. Which of the following sets of loci are parsimony uninformative? Locus 1 2 3 4 5 6 Species A ATG ACA Species B A CGGCT Species C ATCTAA Species D ACG CAT | Species E ACG G TI 0 Locus 1 Loci 1.3.4 Loci 1.3 Loci...
Consider a locus of interest that has two alleles: A and a. A diploid individual carrying these alleles can have one of three genotypes: AA, Aa, or aa; a population will consist of some combination of AA, Aa, and aa individuals. The relatively frequency of each of these genotypes makes up the population's structure. Hardy and Weinberg independently figured out that, in the absence of forces that cause evolutionary change, the population structure will 'settle' or default to equilibrium values,...
When there is a match between a forensic DNA sample collected
at a crime scene and DNA subpoenaed from a suspect, the genotype
frequency can be interpreted in two ways. In one sense, it is the
probability of finding that specific genotype in the population. In
another sense it is the probability that the match is due to
chance.
How does the results from the most common alleles in
the different populations affect the application of using these
results for...
central dogma question
The nucleotide sequence below is from an individual. Only one strand of the chromosome is shown. Write the complementary strand of the DNA below. Watch your polarity! Below are two sequences, A and B. Both of these sequences are from the same gene from two different individuals. Differences in their sequence are highlighted red. What do these two sequences (A and B) represent? Now predict what a DNA gel of digested DNA from individual A and B...
Most questions answered within 3 hours.
-
Hydrobromic acid
dissolves solid iron according to the followiaung reaction:
Fe(s)+2HBr(aq)→
FeBr2(aq)+ H2(g)
Part A. What...
asked 1 hour ago -
Verify the following vector identity in SPHERICAL
COORDINATES.
div(curl(A)) = 0
asked 3 hours ago -
The work function (Φ) for a metal is 7.50×10-19 J.
What is the longest wavelength (nm)...
asked 3 hours ago -
1. Would the following procedural changes cause the
calculated mass percent Ni2+ ion in Ni(NH3)nCl2 to...
asked 5 hours ago -
1. Why does the voltage of the capacitor vary with frequency?
where does this missing voltage...
asked 6 hours ago -
p p please write each step out clearly
3. A manager of a company is considering...
asked 5 hours ago -
On October 1, Ebony Ernst organized Ernst Consulting; on October
3, the owner contributed $83,540 in...
asked 6 hours ago -
A.)As an electron moves through a region of space, its speed
decreases from 9.60 × 106...
asked 6 hours ago -
In java with the netbeans program do:
Through object programming
Create a class "ContadorP", which is...
asked 6 hours ago -
Pattern Corporation acquired all of Science
Company's outstanding stock on January 1, 2016 for $600,000 cash....
asked 6 hours ago -
Here are all accounts Tyler Co. maintains.
Tax expenses $4,750
Common stocks $48,840
SG&A expenses $2,500...
asked 7 hours ago -
Lis
out the types and equation of wind profile and the respective
variables in the fds...
asked 7 hours ago