Draw nucleotide base pairing of dG-rC
Draw the nucleotide base pairing of A-U (10 Points) (Be cognizant of space)
watson -Crick pairing 5. Now draw tautomers of the nucleotides and show alternative base paring that could result form tautomeric shifts:
Question 1 1 pts Why is it important for DNA to have complementary base pairing? O Complementary base pairing allows base pairs to be packed in the most energetically favorable arrangement inside of the double helix structure. O Complementary base pairing will pair a purine with a purine, which are a similar width, thus they are able to hold the sugar-phosphate backbone an equal distance apart along the DNA molecule o Complementary base pairing is only important for maintaining the...
the diagram on the right indicates base pairing between tRNA
nucleotides by red lines. these interactions are responsible for
the folding of cloverleaf secondary structure to L shaped tertiary
structure. draw the chemical structures of G-psi, G-m7G , A-A
pairs, indicate Hydrogen bonds within each pair. estimate the
length of the acceptor stem.
O Constant nucleotide A-OH C75 3. (1 pts) The diagram on the right indicates base pairing between tRNA nucleotides by red lines. These interactions are responsible for...
Considering information flow in the cell, which of the following does not depend on base pairing? a. DNA replication b. Reverse transcription c. Translation d. DNA methylation e. All of these depend on base pairing.
Which nucleotides are capable of base-pairing within the double helix? What characteristics of these nucleotides allow for base-pairing specificity?
Question 8 1 pts Base pairing is an essential property of a DNA helix. Its presence or absence is very important for all of the following EXCEPT: Establishing the 5' to 3' polarity of a piece of DNA Providing a primer for DNA polymerase. Identifying an origin of replication. Identification of a damaged nucleotide that needs to be repaired. The use of a template to make a new daughter strand Question 9 Primase is an essential component of the replication...
which of the following is consistent with follows the
principle of base pairing DNA.
Question 12 2 pts Which of the following is consistent with (follows) the principle of base pairing in DNA? O guanine-cytosine O adenine-guanine O uracil-adenine pyrimidine-pyrimidine purine-purine
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
pleasevanswer asap
Complementary base-pairing is important in processes involving DNA and RNA, including gene expression. Describe the steps during prokaryotic translation where complementary base-pairing of RNA to RNA is essential to translation. Be sure to include what molecules are complementary, and how this base-pairing contributes to translation. T T T Arial 3 (12pt) T.E.E. 3. 25