Answer :)
The trpL sequence is essential for terminating and anti-terminating the trp operon if the tryptophan concentration is slightly efficient and that can be adequate by the trpL coded tryptophan. The attenuator sequence work only when the trpL sequence is transcribed. Therefore, if trpL sequence is not working, then the attenuator sequence will also not work. In the absence of tryptophan, the trp operon will work.
You have discovered a new mutant strain of E.colithat has a mutation in the trpL gene,...
You are studying a mutant strain of bacteria in which the trp operon includes a mutation in region 1 of the 5'UTR. Whereas in the wildtype strain the affected codons code for "trp, in the mutant strain these codons code for "stop". How will this mutation affect attenuation? Translation of the S'UTR will stop at the position of the mutation in region 1. As a result, region 3 of the 5'UTR will pair with region 2 in the mRNA causing...
5.) You have discovered mutants in two new gene mutants in Drosophila. One mutant, curl, has small, curly, nonfunctional wings. The other mutant, big, has enormous eyes. You decide to test if these two new genes are on chromosome #2, so you perform a three-gene linkage testcross using a gene that you know is on chromosome #2, trp, a mutant that cannot make its own tryptophan (and so must get it from its food). In all three cases, these mutant...
consider a strain of E. coli that has a mutation in the gene encoding the IIA protein of the phosphotransferase system. The transport and phosphorylation of glucose is not affected by this mutation and the phosphate group is transferred to glucose as in the wildtype strain. Also, the interaction between the mutant IIA protein and Lacy is not affected by the mutation. However, the mutation does affect the IIA protein's interactions with adenylate cyclase and the phosphorylated form of the...
please help me!!! 5.) You have discovered mutants in two new gene mutants in Drosophila. One mutant, curl, has small, curly, nonfunctional wings. The other mutant, big, has enormous eyes. You decide to test if these two new genes are on chromosome #2, so you perform a three-gene linkage testcross using a gene that you know is on chromosome #2, trp, a mutant that cannot make its own tryptophan (and so must get it from its food). In all three...
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....
Researchers have identified a gene in humans that (when mutant) causes severe dwarfism and mental retardation. This disorder is inherited in an autosomal recessive manner, and the mutant allele is known to be a loss-of-function mutation. The same gene has been found on mice, although a mutant version of the gene has not been discovered in mice. To develop drugs and an effective therapy to treat this disorder, it would be extremely useful to have a mouse model of the...
You have a bacterial strain with a mutation that removes the transcription termination Sinal from the A operon. Which of the following statements describes the most likely effect of this mutation on Abd transcription? The Abd RNA will not be produced in the mutant strain, On The Abd RNA from the mutant strain will be longer than normal. Sigma factor will not dissociate from RNA polymerase when the Abd operon is being transcribed in the mutant strain RNA polymerase will...
As a student project, you have isolated six new mutant strains of E. coli with altered behavior of the lactose operon. The strains are listed in the table below, together with their phenotypes (with regard to significant ?-galactosidase synthesis) in three specific situations. Columns 1 and 2 present the phenotypes of each mutant haploid strain. In column 1, the mutant is in an otherwise wild-type genome. In column 2, the genome also carries a nonsense-suppressor mutation (that is not present...
A new mutation has been discovered that causes cancer. You have identified the gene sequence where the mutation occurs. Below is the sequence from your mother who is normal and you who have this mutation in your DNA. Mother: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUCAACCUAUCCCUAAGGGUAAAAA 3' You: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUGAACCUAUCCCUAAGGGUAAAAA 3' What type of mutation is shown in your DNA sequence? 01) Nonsense 2) Deletion 3) Missense 4) Frame shift
3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect tryptophan biosynthesis. The first mutation is a single nucleotide substitution that converts the second tandem Trp codon in region 1 of the Trp leader sequence into a stop codon (see slides 2-7 of Lecture 24 on iLearn) trp structural genes trpE trpD trpC trpB trpA PO Trp Leader Met-Lys-Ala-lle-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr Ser- Stop Assume that strain 401 also contains a mutation in the gene for the...