Given the dna template shown in the figure below which of the following bases would you...
1a. Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding b. What would be the resulting RNA sequence (written 5′→3′ )? 2. You have learned about the events surrounding DNA replication and the central dogma. Identify the steps associated with these processes that would be adversely affected in the...
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank
5) The following sequence of bases is present along one chain of a DNA double-helix that has opened up at a replication fork, and synthesis of an RNA primer on this template begins by copying the base in bold. 3' - ... TCT GAT ATC AGT ACG ... - 5' a) If the RNA primer consists of 8 nucleotides, what is its base sequence? b) In the intact RNA primer, which nucleotide has a free hydroxyl (-OH) terminus and what...
Question 1 Which of the following pairs is mismatched? DNA polymerase makes a molecule of DNA from a DNA template O DNA ligase joins segments of DNA O Primase incorporates an RNA primer RNA polymerase makes a molecule of RNA from an RNA template O Helicase separates complementary strands of DNA
Develop 3 individual DNA strands that includes all 4 bases and are each 40 bases long. (include directionality for each strand) TT I Arial 3(1201·T·EE: 5.00 From the 3 strands that you just developed, determine the consensus sequence. (include directionality) TT T Arial 3(12pt) T. - E . ES Determine the complementary strand to your consensus sequence with correct base pairing and include directionality for each strand Highlight the strand that would be your template for transcription TTT Arial 3(12pt)...
Would the DNA strand indicated with an arrow in the figure below serve as a template for a leading or a lagging DNA strand? ان TTTTTTTTTTTT- کی 73% Select one a lagging Strand b. Leading Strand o © Type here to search * 00
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...