Question

1a. Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction?
5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′
3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′
⎯⎯⎯⎯→
Direction of DNA unwinding
b. What would be the resulting RNA sequence (written 5′→3′ )?

2. You have learned about the events surrounding DNA replication and the central dogma. Identify the steps associated with these processes that would be adversely affected in
the following scenarios.
a. Helicases unwind the DNA, but stabilizing proteins are mutated and cannot bind to the DNA.
b. The mRNA molecule forms a hairpin loop on itself via complementary base pairing in an area spanning the
AUG start site.
c. The cell is unable to produce functional tRNAi Met

Answer 1

1a. The 3'-5' strand will act as a template strand for transcription. As we know synthesis of a nucleotide chain requires a free 3'OH group. Therefore the 3'-5' strand will act as a template strand for transcription.

1.b. The nucleotide sequence would be

5'-ACGGACUGUACCGCUGAAGUCAUGGUCGCUCGU-3'

2.A. If the DNA strand stabilising proteins also known as single strand binding proteins are mutated and they don't function then the parts melted by helicase will rejoin and the DNA strand won't open and the DNA polymerase won't start the replication process.

2.B. If the m-RNA forms a hairpin loop via complementary base pairing in the region were the translation start codon 5'-AUG-3' is situated then the peptide synthesis via translation from the m-RNA won't happen. As the ribosomal subunits scans for the AUG start codon to initiate translation.

2.C tRNAi(met) is the initiator t-RNA in the eukaryotic system and it helps the ribosome sub units in the scanning and identification of the start codon 5'-AUG-3'. If the cells are not able to produce functional t-RNAi then the translation process will be hampered.