Homework Answers
Add Answer to:
(11%) Problem 7: In a living organism, a fixed fraction l 30 x 10-12 of 12C...
In a living organism a fixed fraction 1.30 x 10-12 of 12C is the radioactive isotope...
In a living organism a fixed fraction 1.30 x 10-12 of 12C is the radioactive isotope 14C, which has a half life of (50%) Problem 2: 5730 y What is the activity of the 14C in 0.55 g of12C found in living tissue in Bq? Grade Summary Deductions Potential 0% 100% tan07 8 9 cosO cotanasin acos( atan0 acotansinhO coshO tanh cotanhO Degrees O Radians in Submissions Attempts remaining: 7 (3%per attempt) detailed view 12 3 0 Submit Hint I...
In a living organism a fixed fraction 1.30 x 10-12 of 12C is the radioactive isotope...
In a living organism a fixed fraction 1.30 x 10-12 of 12C is the radioactive isotope 14C, which has a half life of (50%) Problem 2: 5730 y What is the activity of the 14C in 0.55 g of12C found in living tissue in Bq? Grade Summary Deductions Potential 0% 100% tan07 8 9 cosO cotanasin acos( atan0 acotansinhO coshO tanh cotanhO Degrees O Radians in Submissions Attempts remaining: 7 (3%per attempt) detailed view 12 3 0 Submit Hint I...
This problem is related to the activity of 14 C in a living organism and radioactive...
This problem is related to the activity of 14 C in a living organism and radioactive dating for a dead organism. The half-life of 1.4 C is 5,730 years and assume that in a living organism there is one atom of 1.4 C for every 8.3x 1011 atoms of b?C. Given: the molar mass of b? C is 12 gram/mol and there are 6.02 x 1023 atoms in one mole of a substance. Determine the number of 14 Catoms present...
11. My Notes Ask Your Teacher -/10 points Content Carbon dating An archaeologist finds some ancient...
11. My Notes Ask Your Teacher -/10 points Content Carbon dating An archaeologist finds some ancient jewelry made from bone. The jewelry has a carbon mass of 435 g (HINT: Assume all the carbon is 12C and determine the number of atoms) and careful measurements show that the remaining 14C has a current decay rate of 11 decays/s. Determine the age of the bone (and presumably the jewelry). Remember, the ratio of 14C to 12C when the animal died was...
Course Contents HOMEWORK Set 10 (due Weds 12/4 at 11:59PM) Carbon-14 dating Timer Notes Evaluate ,...
Course Contents HOMEWORK Set 10 (due Weds 12/4 at 11:59PM) Carbon-14 dating Timer Notes Evaluate , Feedback Print The age of a piece of wood from an archeological site is to be determined using the Carbon-14 method. The activity of the şample is measured to be 0.670 times the Carbon-14 activity of living plants. What is the age of the sample in years? (The half-life of the Carbon- 14 isotope is 5730 years.) Tries 0/20 Submit Answer Send Feedback G...
Can someone please help with this question? Note: 57116 or 57300 years for Part A and...
Can someone please help with this question? Note: 57116 or 57300
years for Part A and 11950 years for Part B is NOT correct so
PLEASE DO NOT COPY FROM OTHER CHEGG ANSWERS, THEY ARE WRONG
Question 14 An old campfire is uncovered during an archaeological dig. Its charcoal is found to contain 0.1% the normal amount of 14C. Estimate the minimum age of the charcoal. Enter answer here 57300 years Your 57300 years Answ 1 of 4 attempts used...
Word ...l 7 25% x 7:10 PM cheg2 DOCX - 12 KB la. In the mRNA...
Word ...l 7 25% x 7:10 PM cheg2 DOCX - 12 KB la. In the mRNA sequence ACUAGaugСAGAGCUCAUGCACCACCAGAGA, where the lowercase aug is the translation start site, if the underlined A is changed to a U, will it change the encoded protein sequence? Yes No 1b. What if the underlined G is changed to a C? Yes No lc. What if both changes are made? Yes No 3. What is a possible mRNA sequence that could encode the protein sequence...
what is the answer of 12 and 13 estimated as equivalent to that released by 20.000...
what is the answer of 12 and
13
estimated as equivalent to that released by 20.000 tons of TNT. Assume 200 MeV is released when a 235 U nucleus absorbs a neutron and fission that 3.8 x 10' J is relensed during detonation of 1 ton of TNT. nuclear fissions occurred at Hiroshima, and what was the total de mass? utron and fissions and of 1 ton of TNT. How many was the total decrease in Scanned by CamScann 1.9...
34. Chromium(III) hydroxide has Ksp 1.6 x 10-30. What is the molar solubility of Cr(OH)3 in a solution whose pH is maintained at 6.00? (A) 1.6 x 10-12 mol L-1 (C) 3.6 х 10-8 mol L-1 (B) 1.6 x 10- mol...
34. Chromium(III) hydroxide has Ksp 1.6 x 10-30. What is the molar solubility of Cr(OH)3 in a solution whose pH is maintained at 6.00? (A) 1.6 x 10-12 mol L-1 (C) 3.6 х 10-8 mol L-1 (B) 1.6 x 10- mol L-1 (D) 1.6 x 106 mol L-1 35. At 400 K, this reaction has Kp- 8.2 x 10. SO3(g)SO2(g)/ 02(g) What is Kp at 400 K for the following reaction? 2 SO3(g) 2 SO2(g) + O2(g) (B) 8.2 x...
ssignment: Chpater 11 0 X Assignment Score: 27.27% Save muestions Problem 11-12 (Calculation of g L...
ssignment: Chpater 11 0 X Assignment Score: 27.27% Save muestions Problem 11-12 (Calculation of g L and EPS) Submit Assignment for Grading Question 8 of 11 Check My Work eBook Calculation of g and EPS Spencer Supplies' stock is currently selling for $60 a share. The firm is expected to earn $5.40 per share this year and to pay a year-end dividend of $2.60. a. If investors require a 9% return, what rate of growth must be expected for Spencer?...
In a living organism a fixed fraction 1.30 x 10-12 of 12C is the radioactive isotope 14C, which has a half life of (50%) Problem 2: 5730 y What is the activity of the 14C in 0.55 g of12C found in living tissue in Bq? Grade Summary Deductions Potential 0% 100% tan07 8 9 cosO cotanasin acos( atan0 acotansinhO coshO tanh cotanhO Degrees O Radians in Submissions Attempts remaining: 7 (3%per attempt) detailed view 12 3 0 Submit Hint I...
In a living organism a fixed fraction 1.30 x 10-12 of 12C is the radioactive isotope 14C, which has a half life of (50%) Problem 2: 5730 y What is the activity of the 14C in 0.55 g of12C found in living tissue in Bq? Grade Summary Deductions Potential 0% 100% tan07 8 9 cosO cotanasin acos( atan0 acotansinhO coshO tanh cotanhO Degrees O Radians in Submissions Attempts remaining: 7 (3%per attempt) detailed view 12 3 0 Submit Hint I...
This problem is related to the activity of 14 C in a living organism and radioactive dating for a dead organism. The half-life of 1.4 C is 5,730 years and assume that in a living organism there is one atom of 1.4 C for every 8.3x 1011 atoms of b?C. Given: the molar mass of b? C is 12 gram/mol and there are 6.02 x 1023 atoms in one mole of a substance. Determine the number of 14 Catoms present...
11. My Notes Ask Your Teacher -/10 points Content Carbon dating An archaeologist finds some ancient jewelry made from bone. The jewelry has a carbon mass of 435 g (HINT: Assume all the carbon is 12C and determine the number of atoms) and careful measurements show that the remaining 14C has a current decay rate of 11 decays/s. Determine the age of the bone (and presumably the jewelry). Remember, the ratio of 14C to 12C when the animal died was...
Course Contents HOMEWORK Set 10 (due Weds 12/4 at 11:59PM) Carbon-14 dating Timer Notes Evaluate , Feedback Print The age of a piece of wood from an archeological site is to be determined using the Carbon-14 method. The activity of the şample is measured to be 0.670 times the Carbon-14 activity of living plants. What is the age of the sample in years? (The half-life of the Carbon- 14 isotope is 5730 years.) Tries 0/20 Submit Answer Send Feedback G...
Can someone please help with this question? Note: 57116 or 57300
years for Part A and 11950 years for Part B is NOT correct so
PLEASE DO NOT COPY FROM OTHER CHEGG ANSWERS, THEY ARE WRONG
Question 14 An old campfire is uncovered during an archaeological dig. Its charcoal is found to contain 0.1% the normal amount of 14C. Estimate the minimum age of the charcoal. Enter answer here 57300 years Your 57300 years Answ 1 of 4 attempts used...
Word ...l 7 25% x 7:10 PM cheg2 DOCX - 12 KB la. In the mRNA sequence ACUAGaugСAGAGCUCAUGCACCACCAGAGA, where the lowercase aug is the translation start site, if the underlined A is changed to a U, will it change the encoded protein sequence? Yes No 1b. What if the underlined G is changed to a C? Yes No lc. What if both changes are made? Yes No 3. What is a possible mRNA sequence that could encode the protein sequence...
what is the answer of 12 and
13
estimated as equivalent to that released by 20.000 tons of TNT. Assume 200 MeV is released when a 235 U nucleus absorbs a neutron and fission that 3.8 x 10' J is relensed during detonation of 1 ton of TNT. nuclear fissions occurred at Hiroshima, and what was the total de mass? utron and fissions and of 1 ton of TNT. How many was the total decrease in Scanned by CamScann 1.9...
34. Chromium(III) hydroxide has Ksp 1.6 x 10-30. What is the molar solubility of Cr(OH)3 in a solution whose pH is maintained at 6.00? (A) 1.6 x 10-12 mol L-1 (C) 3.6 х 10-8 mol L-1 (B) 1.6 x 10- mol L-1 (D) 1.6 x 106 mol L-1 35. At 400 K, this reaction has Kp- 8.2 x 10. SO3(g)SO2(g)/ 02(g) What is Kp at 400 K for the following reaction? 2 SO3(g) 2 SO2(g) + O2(g) (B) 8.2 x...
ssignment: Chpater 11 0 X Assignment Score: 27.27% Save muestions Problem 11-12 (Calculation of g L and EPS) Submit Assignment for Grading Question 8 of 11 Check My Work eBook Calculation of g and EPS Spencer Supplies' stock is currently selling for $60 a share. The firm is expected to earn $5.40 per share this year and to pay a year-end dividend of $2.60. a. If investors require a 9% return, what rate of growth must be expected for Spencer?...
Most questions answered within 3 hours.
-
R2.84: There are 2 defective products in a production lot of 10.
An inspector randomly selected...
asked 58 minutes ago -
Consider the following equilibrium system: COCl2(g) CO(g) +
Cl2(g) A 10.00 L evacuated flask is filled...
asked 1 hour ago -
1) What are the two distinct steps that one needs to perform
when developing a data...
asked 1 hour ago -
2) Write a C++ program that uses a class called “Degree” to
obtain the trigonometric
values...
asked 2 hours ago -
1. In eukaryotic cells the genomes of
&
asked 2 hours ago -
The standard enthalpy of propanol (C3H7OH) is -303.0 kJ/mol.
Compute both of the
gross and net...
asked 2 hours ago -
Why PWM using H-bridge for control motor speed is more power
effiecient than the linear amplifier...
asked 2 hours ago -
In 1999, Carly Fiorina famously said,"I hope that we are at a
point that everyone is...
asked 2 hours ago -
Individuals in a species of moth vary in wing color from white to
black, but all...
asked 3 hours ago -
The following standards for variable manufacturing overhead have
been established for a company that makes only...
asked 3 hours ago -
The United States government wanted to determine what proportion
of Americans approve of the current president,...
asked 3 hours ago -
2-N stone is dropped from the top of a cliff. The stone hits the
ground 3...
asked 3 hours ago