1) What determines whether a protein will be translated in the cytosol or on the ER surface?
2) What is the difference between post-translational ER import and co-translational translocation?
3) Can you explain the steps that ensure a protein is
translated in conjunction with the ER?
( Including names. What is the SRP/SRP
receptor/translocon, etc, and how do they help?)
1)proteins during translation are targeted to ER if they have a signal sequence of about 20 to 30 amino acids, if they don't have these specific sequences then they remain in cytosol.
2) there are two ways for a protein to make its contact with the membrane
the nascent protein may remain associated with the translocation apparatus while being synthesized on the ribosomes. this is called as co-translational translocation.
another way is that the protein gets released from ribosomes after translation and then the complete protein is diffused to the appropriate membrane and associates with the translocation apparatus. This is called post-translational ER import.
1) What determines whether a protein will be translated in the cytosol or on the ER...
What is the correct order for the following steps in co-translating a soluble protein into the ER lumen? #1 Choose... Translocation of the protein through the translocator begins. Signal sequence is cleaved by signal peptidase. ER Signal sequence binds to the translocator channel. SRP binds SRP Receptor. Translation begins. SRP binds ER signal sequence. Ribosome dissociates from ER membrane. Translation of the polypeptide finishes. Ribosome binds mRNA. Translation pauses. Choose.. Choose... Choose... #9 Choose... #10 Choose...
Beside the SRP path, are there other options for getting a protein into the ER? What are they and explain their mechanism of entry? Describe the structure of the translocon sec61 and its partners. how is it plugged and how does the seam allow lateral transfer
What is Co-translational insertion of secreted and transmembrane proteins into the ER membrane including translocon, secreted proteins, type 1 transmembrane protein, type 2 transmembrane proteins?
Protein trafficking has been one of the biggest challenges to explore and elucidate in the past few decades. Yet we now know much about this multi-step process. d. Explain how proteases were used with rough microsomes to demonstrate the presumed presence of an SRP receptor. e. Explain the differences between co-translational translocation versus post-translational translocation of newly synthesized proteins. What is the role of Bip in the latter process? f. Challenge: You are studying a particular protein (Protein Z) that...
is to post-translational ER protein import. O PDI (multiple choice) Mitochondrial hsp 70 is to matrix protein import what Ribosome Osec61 Osec63 O BiP 9. O co
When a protein is co-translationally translocated into the ER it sometimes receives attachments of eight mannose residues, which are added to a core carbohydrate unit consisting of GlcNAc (N-acetylglucosamine). The mannose residues are trimmed down from a unit of eight to a unit of five either in the ER prior to transport to the Golgi, or in the cis-Golgi after transport The removal of three mannose residues can be detected using gel electrophoresis because proteins modified in this way will...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
A115/A140: Study Packet for The Story of the Human Body.Part .by Daniel Leiberman Sp 19 of the Human Body, Ch. 1-Introduction: What are Humans Adapted For? READ Introduction and, as a study project, trace the evolutionary history and adaptive significance of each of the following foundational adaptations, adaptive patterns that we modern humans have inherited from our n Hearing System (focus on the evolution of the mammalian hearing system Human Vision System (stereoscopic, trichromatic color vision) The Modern Human Brain...
1. According to the paper, what does lactate dehydrogenase (LDH) do and what does it allow to happen within the myofiber? (5 points) 2. According to the paper, what is the major disadvantage of relying on glycolysis during high-intensity exercise? (5 points) 3. Using Figure 1 in the paper, briefly describe the different sources of ATP production at 50% versus 90% AND explain whether you believe this depiction of ATP production applies to a Type IIX myofiber in a human....
1. What is the definition of an 'equivalence point' in an acid/base titration? (1 point) 2. In part one of the experiment, you will prepare the acid solutions being titrated from a stock solution. Describe how you will accurately prepare 10.00 mL of 0.100 M HCl solution using a 1.00 M HCl stock solution. In your response to this question, be very specific about the quantities of stock solution and deionized water to be used in the dilution and the...